ID: 1131060436

View in Genome Browser
Species Human (GRCh38)
Location 15:89400598-89400620
Sequence AGATCGCCGGCCTTTCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131060432_1131060436 -10 Left 1131060432 15:89400585-89400607 CCGAGGCCCAGTAAGATCGCCGG No data
Right 1131060436 15:89400598-89400620 AGATCGCCGGCCTTTCCCAAAGG No data
1131060431_1131060436 -6 Left 1131060431 15:89400581-89400603 CCAGCCGAGGCCCAGTAAGATCG No data
Right 1131060436 15:89400598-89400620 AGATCGCCGGCCTTTCCCAAAGG No data
1131060430_1131060436 -5 Left 1131060430 15:89400580-89400602 CCCAGCCGAGGCCCAGTAAGATC No data
Right 1131060436 15:89400598-89400620 AGATCGCCGGCCTTTCCCAAAGG No data
1131060428_1131060436 25 Left 1131060428 15:89400550-89400572 CCTGGGCGGTGGGTATGGAGGGC No data
Right 1131060436 15:89400598-89400620 AGATCGCCGGCCTTTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131060436 Original CRISPR AGATCGCCGGCCTTTCCCAA AGG Intergenic
No off target data available for this crispr