ID: 1131061159

View in Genome Browser
Species Human (GRCh38)
Location 15:89405547-89405569
Sequence GAGTCAGATTTGGGTGCGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131061155_1131061159 -8 Left 1131061155 15:89405532-89405554 CCCTTGGTGGTTCTGGAGTCAGA No data
Right 1131061159 15:89405547-89405569 GAGTCAGATTTGGGTGCGTTTGG No data
1131061148_1131061159 27 Left 1131061148 15:89405497-89405519 CCACATAAAAATTTTCATGGGTG No data
Right 1131061159 15:89405547-89405569 GAGTCAGATTTGGGTGCGTTTGG No data
1131061156_1131061159 -9 Left 1131061156 15:89405533-89405555 CCTTGGTGGTTCTGGAGTCAGAT No data
Right 1131061159 15:89405547-89405569 GAGTCAGATTTGGGTGCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131061159 Original CRISPR GAGTCAGATTTGGGTGCGTT TGG Intergenic
No off target data available for this crispr