ID: 1131063165

View in Genome Browser
Species Human (GRCh38)
Location 15:89416857-89416879
Sequence CAGCCCGGAGTGTCCCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131063165_1131063171 7 Left 1131063165 15:89416857-89416879 CCTGGCGGGGACACTCCGGGCTG No data
Right 1131063171 15:89416887-89416909 GCGTACAAGGGGCCTCCTCATGG No data
1131063165_1131063168 -6 Left 1131063165 15:89416857-89416879 CCTGGCGGGGACACTCCGGGCTG No data
Right 1131063168 15:89416874-89416896 GGGCTGCAGGTGTGCGTACAAGG No data
1131063165_1131063173 17 Left 1131063165 15:89416857-89416879 CCTGGCGGGGACACTCCGGGCTG No data
Right 1131063173 15:89416897-89416919 GGCCTCCTCATGGCAGTTTTGGG No data
1131063165_1131063169 -5 Left 1131063165 15:89416857-89416879 CCTGGCGGGGACACTCCGGGCTG No data
Right 1131063169 15:89416875-89416897 GGCTGCAGGTGTGCGTACAAGGG No data
1131063165_1131063172 16 Left 1131063165 15:89416857-89416879 CCTGGCGGGGACACTCCGGGCTG No data
Right 1131063172 15:89416896-89416918 GGGCCTCCTCATGGCAGTTTTGG No data
1131063165_1131063170 -4 Left 1131063165 15:89416857-89416879 CCTGGCGGGGACACTCCGGGCTG No data
Right 1131063170 15:89416876-89416898 GCTGCAGGTGTGCGTACAAGGGG No data
1131063165_1131063174 18 Left 1131063165 15:89416857-89416879 CCTGGCGGGGACACTCCGGGCTG No data
Right 1131063174 15:89416898-89416920 GCCTCCTCATGGCAGTTTTGGGG No data
1131063165_1131063176 21 Left 1131063165 15:89416857-89416879 CCTGGCGGGGACACTCCGGGCTG No data
Right 1131063176 15:89416901-89416923 TCCTCATGGCAGTTTTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131063165 Original CRISPR CAGCCCGGAGTGTCCCCGCC AGG (reversed) Intergenic
No off target data available for this crispr