ID: 1131063574

View in Genome Browser
Species Human (GRCh38)
Location 15:89418930-89418952
Sequence CTCATCAGGATTCCTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131063574_1131063579 19 Left 1131063574 15:89418930-89418952 CCTGGAAGAGGAATCCTGATGAG No data
Right 1131063579 15:89418972-89418994 TCCAGTTCAAAAGTGATCAGGGG No data
1131063574_1131063577 17 Left 1131063574 15:89418930-89418952 CCTGGAAGAGGAATCCTGATGAG No data
Right 1131063577 15:89418970-89418992 AATCCAGTTCAAAAGTGATCAGG No data
1131063574_1131063578 18 Left 1131063574 15:89418930-89418952 CCTGGAAGAGGAATCCTGATGAG No data
Right 1131063578 15:89418971-89418993 ATCCAGTTCAAAAGTGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131063574 Original CRISPR CTCATCAGGATTCCTCTTCC AGG (reversed) Intergenic
No off target data available for this crispr