ID: 1131068451

View in Genome Browser
Species Human (GRCh38)
Location 15:89449028-89449050
Sequence TGCCAAAGGCATCCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131068443_1131068451 26 Left 1131068443 15:89448979-89449001 CCCTGGGTGTGATGAATGCCAGG No data
Right 1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG No data
1131068447_1131068451 8 Left 1131068447 15:89448997-89449019 CCAGGGCTGCTTACAGAGTCACA No data
Right 1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG No data
1131068445_1131068451 25 Left 1131068445 15:89448980-89449002 CCTGGGTGTGATGAATGCCAGGG No data
Right 1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG No data
1131068442_1131068451 29 Left 1131068442 15:89448976-89448998 CCTCCCTGGGTGTGATGAATGCC No data
Right 1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131068451 Original CRISPR TGCCAAAGGCATCCCCGGCC TGG Intergenic
No off target data available for this crispr