ID: 1131069002

View in Genome Browser
Species Human (GRCh38)
Location 15:89452618-89452640
Sequence GAACCCTCCCCCAGAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131069002_1131069010 3 Left 1131069002 15:89452618-89452640 CCCCACCCTCTGGGGGAGGGTTC No data
Right 1131069010 15:89452644-89452666 GTGGTTTAAGTCATTCACAGAGG No data
1131069002_1131069013 28 Left 1131069002 15:89452618-89452640 CCCCACCCTCTGGGGGAGGGTTC No data
Right 1131069013 15:89452669-89452691 CCAGTCCTCACACCAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131069002 Original CRISPR GAACCCTCCCCCAGAGGGTG GGG (reversed) Intergenic
No off target data available for this crispr