ID: 1131070273

View in Genome Browser
Species Human (GRCh38)
Location 15:89461535-89461557
Sequence GCCTAATCCCGTGGGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131070273_1131070285 26 Left 1131070273 15:89461535-89461557 CCACAGCTCCCACGGGATTAGGC No data
Right 1131070285 15:89461584-89461606 GGCACAGGCTGCCCAGGGACAGG No data
1131070273_1131070282 11 Left 1131070273 15:89461535-89461557 CCACAGCTCCCACGGGATTAGGC No data
Right 1131070282 15:89461569-89461591 CCTGGACACTGTTCAGGCACAGG No data
1131070273_1131070283 20 Left 1131070273 15:89461535-89461557 CCACAGCTCCCACGGGATTAGGC No data
Right 1131070283 15:89461578-89461600 TGTTCAGGCACAGGCTGCCCAGG No data
1131070273_1131070284 21 Left 1131070273 15:89461535-89461557 CCACAGCTCCCACGGGATTAGGC No data
Right 1131070284 15:89461579-89461601 GTTCAGGCACAGGCTGCCCAGGG No data
1131070273_1131070280 5 Left 1131070273 15:89461535-89461557 CCACAGCTCCCACGGGATTAGGC No data
Right 1131070280 15:89461563-89461585 AGGCTGCCTGGACACTGTTCAGG No data
1131070273_1131070277 -7 Left 1131070273 15:89461535-89461557 CCACAGCTCCCACGGGATTAGGC No data
Right 1131070277 15:89461551-89461573 ATTAGGCCCAGCAGGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131070273 Original CRISPR GCCTAATCCCGTGGGAGCTG TGG (reversed) Intergenic