ID: 1131071082

View in Genome Browser
Species Human (GRCh38)
Location 15:89466352-89466374
Sequence AGGGGTCTGCAATTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131071068_1131071082 13 Left 1131071068 15:89466316-89466338 CCCCACTTCTTTGCCCAACCCTT No data
Right 1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG No data
1131071077_1131071082 -5 Left 1131071077 15:89466334-89466356 CCCTTAGAGAGGGATCTGAGGGG No data
Right 1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG No data
1131071067_1131071082 14 Left 1131071067 15:89466315-89466337 CCCCCACTTCTTTGCCCAACCCT No data
Right 1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG No data
1131071079_1131071082 -6 Left 1131071079 15:89466335-89466357 CCTTAGAGAGGGATCTGAGGGGT No data
Right 1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG No data
1131071069_1131071082 12 Left 1131071069 15:89466317-89466339 CCCACTTCTTTGCCCAACCCTTA No data
Right 1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG No data
1131071073_1131071082 0 Left 1131071073 15:89466329-89466351 CCCAACCCTTAGAGAGGGATCTG No data
Right 1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG No data
1131071070_1131071082 11 Left 1131071070 15:89466318-89466340 CCACTTCTTTGCCCAACCCTTAG No data
Right 1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG No data
1131071074_1131071082 -1 Left 1131071074 15:89466330-89466352 CCAACCCTTAGAGAGGGATCTGA No data
Right 1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131071082 Original CRISPR AGGGGTCTGCAATTGGAGGA TGG Intergenic
No off target data available for this crispr