ID: 1131071707

View in Genome Browser
Species Human (GRCh38)
Location 15:89470300-89470322
Sequence ACGTCGGCAAAGATGGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131071707_1131071712 26 Left 1131071707 15:89470300-89470322 CCGGCTTCCATCTTTGCCGACGT No data
Right 1131071712 15:89470349-89470371 TGCTGACAAGTTCCAGAAACAGG No data
1131071707_1131071710 -1 Left 1131071707 15:89470300-89470322 CCGGCTTCCATCTTTGCCGACGT No data
Right 1131071710 15:89470322-89470344 TTTAATTAACATGCTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131071707 Original CRISPR ACGTCGGCAAAGATGGAAGC CGG (reversed) Intergenic
No off target data available for this crispr