ID: 1131071851

View in Genome Browser
Species Human (GRCh38)
Location 15:89471088-89471110
Sequence CTCCCTTCTCGCAGTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131071846_1131071851 -8 Left 1131071846 15:89471073-89471095 CCAAAGGAGCCCTCCCTCCCTTC No data
Right 1131071851 15:89471088-89471110 CTCCCTTCTCGCAGTCCTGCTGG No data
1131071845_1131071851 -7 Left 1131071845 15:89471072-89471094 CCCAAAGGAGCCCTCCCTCCCTT No data
Right 1131071851 15:89471088-89471110 CTCCCTTCTCGCAGTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131071851 Original CRISPR CTCCCTTCTCGCAGTCCTGC TGG Intergenic
No off target data available for this crispr