ID: 1131072282

View in Genome Browser
Species Human (GRCh38)
Location 15:89473374-89473396
Sequence CCAGGACCACAGATGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131072282_1131072296 27 Left 1131072282 15:89473374-89473396 CCTTGCCCCATCTGTGGTCCTGG 0: 1
1: 0
2: 2
3: 39
4: 350
Right 1131072296 15:89473424-89473446 GAGAAGCCACCTCACTCCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131072282 Original CRISPR CCAGGACCACAGATGGGGCA AGG (reversed) Intronic
900489405 1:2939415-2939437 CCATCCCCACAGATGGGGGAAGG + Intergenic
900650280 1:3727024-3727046 CCAGGACCAGACATGGAGCTGGG + Intronic
901059329 1:6464920-6464942 CCAGGAAGAGAGAAGGGGCAAGG + Intronic
901950873 1:12745172-12745194 CAGAGACCACAGTTGGGGCAGGG - Intergenic
902376607 1:16032921-16032943 CCAGCAGCACAGAGGGGGCGGGG - Intronic
902381772 1:16056175-16056197 CCAGCAGCACAGAGGGGGCGGGG - Intronic
902664032 1:17925031-17925053 CCAAGACTACATATTGGGCATGG - Intergenic
902984617 1:20148115-20148137 CCAGGACTACTGCTGGGGAAGGG - Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
903534808 1:24059927-24059949 GCAGGACCCCAGATGGGGAGGGG + Intronic
904258055 1:29269499-29269521 CCAGGACGGAAGCTGGGGCAGGG + Intronic
904328121 1:29740428-29740450 CCAGGACCAGATCTGGGCCATGG + Intergenic
904453152 1:30629572-30629594 GCAGGACCACAGGTGTGGTAGGG + Intergenic
904925951 1:34048377-34048399 CCAGGCCCTCAGATGGTGCCAGG + Intronic
904976614 1:34461599-34461621 GCAGGGCCAGAGGTGGGGCAGGG + Intergenic
905303133 1:36999086-36999108 TCAGGGGAACAGATGGGGCATGG + Intronic
905908733 1:41639315-41639337 CCAGCACCACAGAAGTAGCATGG + Intronic
906157573 1:43622774-43622796 CCAGAACCACAGATGTGTCTGGG + Exonic
907316832 1:53577614-53577636 CCAGGGCCACAGCTGTAGCAGGG - Intronic
910062526 1:83111084-83111106 CCAGGACCCCACAGTGGGCAGGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912584998 1:110754285-110754307 CCATGACCACCCCTGGGGCAAGG - Intergenic
913168655 1:116212243-116212265 CCAGGTTCTAAGATGGGGCAAGG + Intergenic
915748688 1:158184155-158184177 CCAGAGACACAGATGTGGCAAGG - Exonic
916059081 1:161086628-161086650 CCAGGGCAAGAGATGGGGGAGGG + Intronic
916179485 1:162070971-162070993 CCAGGTCCACCGTTGGGGGAGGG + Intronic
916330911 1:163615708-163615730 AGAGGAACACAGATTGGGCAAGG + Intergenic
916750947 1:167722253-167722275 CCAGGACCAGGGCTGGGGCCGGG + Intronic
919771062 1:201158868-201158890 CCAGACCCACAGCTGTGGCACGG - Intronic
920204597 1:204282470-204282492 CCTGGCCCAGAGATGGGGCAGGG - Intronic
922085593 1:222344003-222344025 CAAGGACCACAAATGGAGCAAGG + Intergenic
922543591 1:226437137-226437159 CAAGCATAACAGATGGGGCAAGG + Intergenic
922728966 1:227940229-227940251 CCTGGACCCCAGAAGGGGCATGG + Intronic
1064699332 10:18002377-18002399 TCAGGACCACAGATAGGGGATGG - Intronic
1065995931 10:31059573-31059595 CCAGGATCACAGGTTGTGCAGGG - Intergenic
1066167934 10:32808276-32808298 TCAGGGCAACTGATGGGGCAAGG - Intronic
1066708117 10:38203169-38203191 ACAGGTCCACAGCTGGGACATGG - Intergenic
1067220583 10:44341306-44341328 CCAGGACCATACAGAGGGCAAGG - Intergenic
1067828258 10:49595211-49595233 CCAGCAGGACAGCTGGGGCAAGG - Intergenic
1069849860 10:71397593-71397615 CCAGGACCGGGGATGGGGGATGG - Intronic
1070679238 10:78437112-78437134 CGAAGACCACAGAGGGAGCAGGG - Intergenic
1071054931 10:81498671-81498693 TCAAGCCCAAAGATGGGGCAGGG - Intergenic
1071573213 10:86709280-86709302 CCTGGGCCACACATGGGGAAAGG + Intronic
1073336775 10:102715383-102715405 CCAGGACTACAGATGGTACGCGG - Intronic
1073576609 10:104631238-104631260 CCAGGGCCAATGATGGGGCAGGG - Intergenic
1074028627 10:109663145-109663167 CCAGGTCCACAGCTGTGGCTTGG - Intergenic
1074901318 10:117818554-117818576 CCAGGACAAAAAATGGGGAATGG - Intergenic
1075862675 10:125690670-125690692 CCAGGTCCACAACTGGAGCAGGG - Intergenic
1076122593 10:127948132-127948154 CCAGGAGAGCAGATGGGGAAGGG + Intronic
1076602564 10:131668289-131668311 CTAGGAACAGAGATGGGCCAGGG + Intergenic
1076854003 10:133106402-133106424 GCAGGACCACAGCTTGGGCCTGG - Intronic
1077119561 11:900562-900584 ACAGGGGCACAGATGGGCCAGGG + Intronic
1077342683 11:2033040-2033062 TCAGGCCCACAGCTTGGGCAGGG + Intergenic
1078849119 11:15148048-15148070 CCAGGAGCACAGCAGGGACAAGG + Intronic
1080004171 11:27387631-27387653 CCAGGGACACACATGTGGCAGGG + Intronic
1080864471 11:36180948-36180970 CCAGTAACAGAGATGGGGCAGGG + Intronic
1081678574 11:44985944-44985966 CCAGGACCACAGGATAGGCATGG - Intergenic
1083063444 11:59898473-59898495 CCAGGAACAGAGATGGAGTAAGG - Intergenic
1083339170 11:61947596-61947618 CCAGGACCATAGACAGTGCATGG - Intergenic
1083691444 11:64411338-64411360 CCAGGATCACAGTGGGGACAAGG + Intergenic
1083749300 11:64752640-64752662 CCAGCCGCCCAGATGGGGCACGG + Intronic
1083756392 11:64793933-64793955 CCAGGACCACATCTGGAGCCCGG - Intronic
1084051439 11:66602746-66602768 CCTGGGCCCCAGGTGGGGCAGGG + Intronic
1084182878 11:67455422-67455444 CCATGACCACAGAGCAGGCAAGG + Exonic
1084196007 11:67523882-67523904 CCAGGACCCCAGCTGGGCCCTGG + Intergenic
1084500858 11:69534340-69534362 CCAGGTGCACTGATGGGGCCGGG - Intergenic
1084972609 11:72780173-72780195 CCAGGGGACCAGATGGGGCAGGG - Intronic
1087271984 11:96121191-96121213 CCAGGGCCAAAGATGGGGTTTGG - Intronic
1090498016 11:127233551-127233573 CCAGGCACACAGAGAGGGCAGGG - Intergenic
1090627595 11:128619787-128619809 CCAGGAAAACAGATGGGGAAGGG + Intergenic
1090668998 11:128933175-128933197 CCAGGTCCACAGATGGTGACAGG - Intergenic
1090748099 11:129723327-129723349 CCAGGCCCACACAGGTGGCAAGG + Intergenic
1091287340 11:134414972-134414994 CCAGGATCAGAGCGGGGGCAGGG - Intergenic
1202825669 11_KI270721v1_random:88229-88251 TCAGGCCCACAGCTTGGGCAGGG + Intergenic
1091403837 12:196812-196834 GCAGGACCACAGCTGGGATAAGG + Exonic
1093445470 12:19251878-19251900 TCAGGACCACAGGAAGGGCAGGG - Intronic
1094399312 12:30044543-30044565 CTTGGACTAGAGATGGGGCAAGG + Intergenic
1094417686 12:30234869-30234891 TCAGGACCAGTGGTGGGGCAGGG + Intergenic
1095092063 12:38116968-38116990 CCATGAAAACTGATGGGGCACGG - Intergenic
1100747196 12:97659473-97659495 GGAGGAACACAGAAGGGGCATGG - Intergenic
1100847751 12:98678457-98678479 CCAGGTCCACAGCTGTGGCTTGG - Intronic
1101903119 12:108806376-108806398 CCAGGCCCACTGAAGGGGAAAGG - Exonic
1103443691 12:120980581-120980603 CCAGGGCCCCAGATGGGACTGGG + Intronic
1103875396 12:124123278-124123300 CCACCCCCACAGATGGGACAAGG + Intronic
1103894420 12:124263685-124263707 GCAGGACCACAAAGGGGCCAGGG - Intronic
1104812898 12:131629047-131629069 CTCTGACCACAAATGGGGCACGG - Intergenic
1104824070 12:131695886-131695908 CCAGGACCAGGGAAGGGGCCAGG - Intergenic
1104980101 12:132569860-132569882 CCTGGGCCACAGGAGGGGCAGGG + Intronic
1105437446 13:20390809-20390831 CCAGGACCACAACTGGGCCTCGG - Intergenic
1106208537 13:27620922-27620944 CCAGGAGAACAGGTGGCGCAGGG + Exonic
1106209890 13:27632127-27632149 ACAAGACAACAGATGAGGCATGG - Intronic
1107483258 13:40802865-40802887 GCAAAAGCACAGATGGGGCAGGG - Intronic
1112418744 13:99228178-99228200 ACAGGACTGCAGATGGAGCAGGG - Intronic
1114668485 14:24396264-24396286 CAAGTTCCAGAGATGGGGCAGGG - Intergenic
1119668048 14:76498836-76498858 CCCAGGCCACAGATGGGGGAGGG - Intronic
1119924988 14:78485022-78485044 ACAGGACCAAGGATGAGGCAAGG - Intronic
1121002796 14:90464357-90464379 CCAGGAGCACAGAGGAGGGAGGG - Intergenic
1122330281 14:100907354-100907376 CCAGCACCACAGCTGGGACTTGG - Intergenic
1122540668 14:102496150-102496172 CCAAGACCACAGATGTAGCAGGG + Intronic
1123492130 15:20789280-20789302 CCTGGAACAAAGATGGGGCCTGG - Intergenic
1123548634 15:21358370-21358392 CCTGGAACAAAGATGGGGCCTGG - Intergenic
1124022007 15:25933735-25933757 CTAGGGCCTGAGATGGGGCAGGG - Intergenic
1124209079 15:27747232-27747254 CAAGGACCCCTGCTGGGGCATGG + Intergenic
1124948869 15:34297564-34297586 CCAAGACCACAGCTGAGGCCTGG - Intronic
1126684105 15:51232305-51232327 CAAATACCACTGATGGGGCAAGG - Intronic
1126695032 15:51318540-51318562 CCATGACCCCACATGGGTCAGGG + Intronic
1129077507 15:73009656-73009678 AGGGGACCACAGCTGGGGCATGG - Intergenic
1129383179 15:75180681-75180703 CCAGGACCACAGATGCATCCCGG + Intergenic
1130196169 15:81782223-81782245 CCAAGACAACAGATGGGACTGGG + Intergenic
1130994963 15:88898602-88898624 GGAGGACCACAGGTGGGGGATGG + Intergenic
1131072282 15:89473374-89473396 CCAGGACCACAGATGGGGCAAGG - Intronic
1131278469 15:91002005-91002027 TCAGGACAACAGCTGGAGCAGGG + Intronic
1132360337 15:101207827-101207849 TCAGGACAACGGGTGGGGCAGGG - Intronic
1202956968 15_KI270727v1_random:85601-85623 CCTGGAACAAAGATGGGGCCTGG - Intergenic
1132557538 16:579171-579193 CCTGGACCAGGTATGGGGCAGGG + Exonic
1132580469 16:682494-682516 CCAGGACGCCAGGTAGGGCAGGG - Exonic
1132659794 16:1056171-1056193 CCAGGCCCACAAAGGGGTCAAGG - Intergenic
1132898161 16:2238581-2238603 CCCGTCCCACAGATGGGGAACGG - Exonic
1133317405 16:4893179-4893201 TCAGGAGCACAGGTGGGGCCGGG - Intronic
1135652386 16:24217653-24217675 CCAGCACAACAAACGGGGCAGGG + Exonic
1136344645 16:29666834-29666856 CCAGGAGCACACATGGGCCAGGG + Exonic
1136862714 16:33712867-33712889 GCAGGGCCAGAGCTGGGGCAGGG - Intergenic
1137370756 16:47903732-47903754 CTAAGACCACAGAGGTGGCAGGG + Intergenic
1137390081 16:48074127-48074149 CCAGGCCCACCCATGGGGCCAGG - Intergenic
1137703096 16:50512169-50512191 CCAAGAACACAAATGGGGGAAGG - Intergenic
1138280997 16:55772291-55772313 TCAGGACTACAGATGCGGCTGGG - Intergenic
1138287535 16:55821576-55821598 TCAGGACCACAGATGGGGCTAGG + Intronic
1139325359 16:66148467-66148489 CGAGGCTCACAGATGAGGCAAGG - Intergenic
1139649780 16:68356461-68356483 GCCGGGCCACACATGGGGCAGGG - Intronic
1141234007 16:82198687-82198709 CCAAGAGCACAGATGAAGCAAGG + Intergenic
1141698945 16:85633671-85633693 CCAGGACCCCAGATGCTGAACGG - Intronic
1141700534 16:85640128-85640150 CCAGCACCACCCATGGTGCAGGG + Intronic
1141860973 16:86716034-86716056 ACAGGACTCCAGATGTGGCAAGG - Intergenic
1203124190 16_KI270728v1_random:1561009-1561031 GCAGGGCCAGAGCTGGGGCAGGG - Intergenic
1142553317 17:753875-753897 CCAGCACCACAGAGGGGAGAGGG + Intronic
1143032761 17:3976915-3976937 CCAGGTCCTCAGATGGGGCCCGG + Intergenic
1143633845 17:8153221-8153243 CCAGGACTACAGAGGGACCAAGG + Intronic
1146258858 17:31408786-31408808 CAAGGAGAACAGCTGGGGCAGGG + Intronic
1146258914 17:31409085-31409107 CCAAGACCACACACGGGCCAGGG - Intronic
1147599855 17:41738892-41738914 CCTGGATCAGAGATGGGGGAGGG - Intergenic
1148644396 17:49210897-49210919 CCAGGGCCCCACTTGGGGCAGGG - Intronic
1148692105 17:49534860-49534882 GCAGGACCCTAGATGGGACAGGG + Intergenic
1150267294 17:63839747-63839769 TCAGGGCCACATTTGGGGCAGGG - Intronic
1150338018 17:64344119-64344141 CCAGGCCCACAGTGGGGGCTGGG + Intronic
1150379551 17:64709823-64709845 CTAATACCACAGATGGGGAAGGG - Intergenic
1151444094 17:74152089-74152111 GCAGGGCTACAGATGGAGCAAGG - Intergenic
1151536356 17:74741017-74741039 CCAAGACCACAGAGGTGGCCGGG + Intronic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1151576473 17:74954805-74954827 GCAGGACCAGAGATGGGGACTGG - Intronic
1151816526 17:76474022-76474044 CCAGGACCCCAGGTAGGGCCTGG - Exonic
1151953312 17:77367253-77367275 CCAGGATCACAGACAGTGCATGG - Intronic
1151964736 17:77425468-77425490 CCATGACCAGAGAGGGGGCCAGG - Intronic
1152206248 17:78976216-78976238 CCAGGACAGCATATGGGGCCTGG - Intronic
1153380884 18:4438211-4438233 CCAGGATCAAACATGGTGCATGG + Intronic
1156125042 18:33894051-33894073 CCATTAGTACAGATGGGGCAAGG + Intronic
1156609653 18:38711456-38711478 CCAGGGCCAGAAATGGGACAAGG + Intergenic
1158818989 18:61136371-61136393 CCTGGACCACAGATGTTGCCAGG - Intergenic
1159024016 18:63166357-63166379 CCAGGACCCTGGACGGGGCAGGG + Intronic
1160187581 18:76687594-76687616 ACAGGCACACAGAAGGGGCAGGG + Intergenic
1160406134 18:78647433-78647455 CGGGGACCACAGATGGAGCAGGG - Intergenic
1160431708 18:78817302-78817324 CCAGCACAACAGATGGAGAATGG - Intergenic
1160910816 19:1473006-1473028 CCGGGGCAACAGATGGGGCCGGG - Exonic
1161512644 19:4679946-4679968 CCTGGAAAACAGATGGGGAAGGG + Exonic
1161590029 19:5125371-5125393 CCAGGACCACGCATGGGGAGGGG - Intronic
1161622950 19:5308931-5308953 CCAGGAGCACGGGTGGGGTACGG + Intronic
1162064517 19:8117025-8117047 CCAGGACCACAGGCCAGGCAGGG + Intronic
1162087459 19:8257214-8257236 CCTGGAAGACAGAGGGGGCAGGG - Intronic
1162427295 19:10603989-10604011 CCAGGCCCACACATGAGACAGGG + Intronic
1162896711 19:13768813-13768835 CCACGACCACAGCTGGGGAGGGG - Exonic
1163652473 19:18526236-18526258 CCAAGACCACACACGGGGTAAGG - Intergenic
1163818190 19:19480736-19480758 CGAGGACCACTGAGGGGGCTGGG - Intronic
1164426439 19:28146068-28146090 CGAGGACCAGGGAGGGGGCAAGG - Intergenic
1165230080 19:34381330-34381352 CCAGAGCCAGGGATGGGGCAGGG - Intronic
1165363454 19:35350610-35350632 GCAGGAACACAGAGGGGCCAGGG - Intergenic
1165365604 19:35363058-35363080 GCAGGAACACAGAAGGGCCAGGG - Intergenic
1166144680 19:40826003-40826025 CAGGGACCCCAGATGGGGCAGGG - Intronic
1166183063 19:41122204-41122226 CAGGGACCCCAGATGGGGCAGGG + Intronic
1166315768 19:41988640-41988662 CCAGGAGGATAGCTGGGGCATGG - Intronic
1166642550 19:44506361-44506383 CCAGGAACAGAGATGTGCCAGGG - Intronic
1167117868 19:47498501-47498523 CCAGGATCACAGGGGAGGCAGGG + Intronic
1168008122 19:53507590-53507612 CCAGGTTCACTGATGGGTCAGGG + Intergenic
1168188629 19:54720926-54720948 CGAGGACTACAGATGGGGGGAGG + Intergenic
1168346281 19:55651628-55651650 CCAGGACCACACGTGGAGGAGGG - Intronic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
924963682 2:57196-57218 CCAGGCCCACACCTGGGGAAGGG - Intergenic
925118119 2:1397654-1397676 CAAGGACCAGAGATGCAGCAGGG - Intronic
925187145 2:1856255-1856277 CCAGGAGCACAAAGGGGACAAGG - Intronic
925338294 2:3114818-3114840 CCAGGGCCACAGAGGGATCAAGG - Intergenic
926212187 2:10879266-10879288 CTAGGCCTCCAGATGGGGCACGG - Intergenic
926396200 2:12445426-12445448 CCAGAACCACAGTTTGGACAGGG - Intergenic
926422655 2:12715445-12715467 CCAGGACCACTGACCGAGCAGGG - Intergenic
926742687 2:16125730-16125752 AGAGGGCCACAGATGGGGGAAGG - Intergenic
927197563 2:20558825-20558847 CCATGACCACAGAGGGGGTAGGG + Intergenic
927503944 2:23601228-23601250 CCAGGACCATTGAGGGGGCCCGG + Intronic
928098812 2:28422980-28423002 CCAGGAAGACAGAGGGGACAAGG + Intergenic
928101456 2:28439873-28439895 CCAGGAACCCTGATGGAGCAGGG - Intergenic
928174909 2:29027000-29027022 CCAGGACACCAGGTAGGGCAGGG + Exonic
928839241 2:35585379-35585401 CCATGACCCCAGGAGGGGCAAGG + Intergenic
929552979 2:42906043-42906065 CCAGGACAAGGGAAGGGGCAGGG + Intergenic
929667589 2:43845251-43845273 CCAGGGACCCAGATGGGACATGG + Intronic
932833784 2:75015478-75015500 TCAGGAACACACATGGGGAAAGG + Intergenic
934715247 2:96539276-96539298 CCAAGAGGACAGATGGGGCAAGG - Intronic
934898901 2:98141570-98141592 CCAGTATCAGAGATGGGGCCTGG - Intronic
934984164 2:98872016-98872038 CCAGCAACACAGATGGAGCTGGG + Intronic
936080506 2:109429633-109429655 CCTGGGGCACAGCTGGGGCAGGG - Intronic
937041954 2:118829421-118829443 CCAGGACCACAGCTGCAGCAGGG + Intergenic
938070193 2:128304365-128304387 CCAGGGACAGAGATGGTGCATGG + Intronic
938089317 2:128420905-128420927 CCAGGACAACAGATGCAGCCTGG - Intergenic
938131569 2:128720053-128720075 CCAGGACCCCAGAAGGACCAGGG - Intergenic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
940998475 2:160176196-160176218 AGTGGACCACAGATGGGGGAGGG - Intronic
942305307 2:174601361-174601383 CCAGGCCCACTGATGGGCCAAGG - Intronic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
944417011 2:199489008-199489030 CCAGGACAACAGTTTGGGGACGG - Intergenic
944933668 2:204545631-204545653 CCAGGACCAGCGACAGGGCAGGG + Intergenic
945038089 2:205721474-205721496 GCAGCACCACAGATGGGTCCCGG - Intronic
946327543 2:218992591-218992613 CTGGGACCTCAGCTGGGGCAGGG + Intronic
947702064 2:232242805-232242827 CCAGGACCAAAGTTGAGTCAGGG - Intronic
948063392 2:235058670-235058692 TCTGGACCACTGATGGGGAAAGG - Intergenic
948586912 2:239025606-239025628 CCAGGACCATGGGTGTGGCAGGG - Intergenic
948864527 2:240768578-240768600 CCAGCAGCCCAGGTGGGGCATGG - Intronic
1169914001 20:10670031-10670053 CCAAGACCAGAGCCGGGGCAGGG + Intronic
1171299766 20:24050163-24050185 CCAGGAACACTGCTGGGGCAGGG - Intergenic
1172773478 20:37394658-37394680 CCAGGACTGCAGTTGGGGGAGGG - Intronic
1173033964 20:39390708-39390730 CCAGGAGCACAGAGGCAGCATGG - Intergenic
1173866792 20:46317597-46317619 CCAGGACCAGCTGTGGGGCACGG - Intergenic
1174146357 20:48455267-48455289 CCAGGACCAGAGCTGGGGCCTGG + Intergenic
1175189951 20:57204724-57204746 CCAGGACCACAGATGGGCGCAGG + Intronic
1175310876 20:58010947-58010969 CCAGGAACACAGATCGGGGAGGG - Intergenic
1175517463 20:59578212-59578234 CCAGGGCCCCAGCTGGGCCAGGG + Intronic
1175813558 20:61872057-61872079 CCAGGACCCCAGAGCAGGCAGGG - Intronic
1175858369 20:62134903-62134925 CAGGGACCACAGAAGGGCCAAGG - Exonic
1175946935 20:62563350-62563372 CCAGTAGCACAGAGGGTGCAGGG - Intronic
1176857592 21:13984917-13984939 CCAGGTCCACAGCACGGGCAGGG - Intergenic
1176867015 21:14059305-14059327 CCAGGTCCACAGCACGGGCAGGG + Intergenic
1179007730 21:37529867-37529889 CCAGCACCCCAGATTGGTCAGGG + Intergenic
1179722907 21:43325497-43325519 CCAGGGCCACATGTGGTGCAAGG - Intergenic
1180173001 21:46070183-46070205 GCAGGACCCGAGAGGGGGCATGG + Intergenic
1180275541 22:10635879-10635901 GCTGGACCACAGAAGGGTCAGGG + Intergenic
1180954762 22:19736727-19736749 TCAGGGCCACAGCTGGGGCCTGG + Intergenic
1181021129 22:20103609-20103631 CCAAGAACACAGATGCAGCAGGG - Intronic
1181050055 22:20234191-20234213 CCAGGCCCAGAGGTGGGGCCAGG + Intergenic
1181402820 22:22661616-22661638 ACAGCAGCACAGATGGGGAAGGG - Intergenic
1181442248 22:22942570-22942592 TCAGGACCACTCTTGGGGCAGGG + Intergenic
1181575223 22:23789899-23789921 ACAGCTCCACAGATGGCGCATGG - Intronic
1181639431 22:24188931-24188953 CTGGGACCCCAGATGGGGTAAGG + Exonic
1183187511 22:36300424-36300446 CCAGGGCCACAGCCGAGGCAGGG + Intronic
1183330970 22:37221300-37221322 CCAACACCACCAATGGGGCAGGG - Intergenic
1183650265 22:39149602-39149624 CCTGGACCACAGGAGGGTCAAGG - Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184878624 22:47291176-47291198 CCAGGACCACAGGTGAGTCCTGG - Intergenic
1184989072 22:48155103-48155125 CAAGGACCACTGCTGGTGCATGG + Intergenic
949546744 3:5079652-5079674 CCAGAACCACTCATGGGGGAGGG - Intergenic
950193753 3:10994719-10994741 CCAGGAACTTAGATGGGGCTGGG + Intronic
950647122 3:14383771-14383793 TCAGGGCCACAGCTGGGCCAGGG - Intergenic
950648514 3:14392687-14392709 CCAGGGCCTCAGATGGGGGCTGG + Intergenic
950667731 3:14507374-14507396 CCAGGGCCACACAGTGGGCACGG - Intronic
953473344 3:43185029-43185051 CCAGGACCAGGGATGGAACAGGG + Intergenic
953741474 3:45542615-45542637 CCGGAACCACACATGGGGCCAGG + Intronic
954454137 3:50587945-50587967 CCAGGACCACAGTGGGCCCAGGG + Intergenic
954534149 3:51345486-51345508 CTAGGACTACAGGTGGGGCTAGG - Intronic
957134459 3:76267996-76268018 GCATGACCAGAGATGTGGCAAGG + Intronic
958878074 3:99638300-99638322 TCTTGACCACAGATGGGGAAAGG - Intergenic
960860891 3:122152506-122152528 CCAAGACCACTCAAGGGGCAGGG - Intergenic
961093927 3:124138744-124138766 CCTGGACCACTGAAGGGACATGG + Intronic
961380390 3:126492811-126492833 CCTGGAGCACAGATGGCTCAGGG - Intronic
961391966 3:126557680-126557702 CCAGAGTCAGAGATGGGGCACGG - Intronic
961453091 3:127011338-127011360 CCAGGACCCAAGAGGGGGCCTGG - Intronic
961454631 3:127017929-127017951 CAGGGTCCACAGGTGGGGCATGG - Intronic
963935017 3:151043462-151043484 CCAGGACTACAGCTGGGCAATGG - Intergenic
966862725 3:184239547-184239569 CCAGGCCAACAGTTGGGACAAGG + Exonic
968920245 4:3518742-3518764 TCAGGAACACAGCAGGGGCAGGG - Intronic
969286400 4:6205075-6205097 TCAGGACGACCTATGGGGCAGGG + Intergenic
969325987 4:6444131-6444153 CCAGGACCACAGAATCGACAAGG + Intronic
969476455 4:7425006-7425028 CTCGGCCCACAGATGGGGCAAGG - Intronic
969617487 4:8262176-8262198 AGAGACCCACAGATGGGGCAGGG + Intergenic
972841823 4:42939872-42939894 TCAGGAACACAGATGGAGAATGG - Intronic
975344191 4:73275359-73275381 CCATGACCAAAAATGGGGCTTGG - Intergenic
975377347 4:73661086-73661108 CCAGGAACACACATGGTGCGGGG - Intergenic
977627751 4:99206138-99206160 CTAGGACCACAGACGGGACTAGG + Intronic
979478422 4:121185486-121185508 CCTGGGACATAGATGGGGCAAGG - Intronic
979681627 4:123466444-123466466 GAAGGACATCAGATGGGGCAGGG + Intergenic
985819321 5:2148876-2148898 CGTGGACCACAGATGGGGCAGGG - Intergenic
985855190 5:2418767-2418789 CCAGGACCAGAGATAGTGAATGG - Intergenic
987073317 5:14358167-14358189 CCACGTCCACAGCTGGGGAAGGG - Exonic
988990087 5:36662182-36662204 CCAGGACCACTGATGGTGGCGGG - Intronic
990428404 5:55711650-55711672 CTAGGACCACAGAGGGGGTGAGG - Intronic
992569329 5:78038728-78038750 CCAGGAGGAGAGATGGGGAAAGG + Intronic
994683095 5:102914278-102914300 CCAGGACCCCAAAAGGGGCTGGG + Intronic
995456105 5:112353831-112353853 CTAGGACAACAGATGGGACAAGG + Intronic
997026700 5:130072419-130072441 CCAAGAACACACATGGGGAAAGG - Intronic
997578911 5:135005047-135005069 CCAGGACCACACAGGGAGGAGGG + Intronic
997984460 5:138491929-138491951 CCAAGGCCACAGATCGTGCATGG + Intergenic
998480629 5:142459694-142459716 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
999436937 5:151570573-151570595 CCAGGGCCAAGGATGGGGCAAGG + Intergenic
999461088 5:151758250-151758272 ACAGAACCAGAGAGGGGGCAGGG - Intronic
999649323 5:153749996-153750018 CCAGCACTCCAGATGGGGGAGGG - Intronic
999824809 5:155263848-155263870 CCAGGAGCACAGAGGAGACAGGG + Intergenic
1000374358 5:160565623-160565645 CCACGAACAGAGATGTGGCACGG - Exonic
1000572709 5:162935348-162935370 CCTGGACAGCAGATGTGGCATGG + Intergenic
1001547834 5:172581450-172581472 CCCAGACAACAGATGGGACAAGG + Intergenic
1002321081 5:178376417-178376439 CAGGGACCACAGCTGGGACAGGG + Intronic
1002693799 5:181070634-181070656 CCAAGAGCACAGAGGGGGCTCGG + Intergenic
1003125472 6:3352123-3352145 CCAGGACCACAGATAAGGAAGGG + Intronic
1003185887 6:3830251-3830273 CCAGGATCCCAGATGTGGCGTGG - Intergenic
1004608780 6:17218971-17218993 CCAGGCCCACAAATGTGGCAGGG - Intergenic
1005364127 6:25060447-25060469 CCATGACCACAGTTGAGCCAAGG - Intergenic
1006378627 6:33685174-33685196 ACAGGAGCAGATATGGGGCATGG + Intronic
1006447780 6:34089562-34089584 CCAGGCCCTCAGATGGTGCATGG + Intronic
1006573080 6:35021388-35021410 GCAGGACCACAGATGGGCTCAGG + Intronic
1007397341 6:41585351-41585373 CCAGGAGCCCAGATGGGACAGGG + Intronic
1007658926 6:43470254-43470276 CCAATATCACAGATGGGTCATGG + Intergenic
1007904143 6:45442432-45442454 CCAAGTCCACAGATGGAACAAGG - Intronic
1011495547 6:87933692-87933714 CCAGGAGGCCAGCTGGGGCATGG - Intergenic
1016122746 6:140364103-140364125 CCATGGCTTCAGATGGGGCAAGG + Intergenic
1016992675 6:149940896-149940918 CCAGGTCCACGGATGGCACAGGG - Intergenic
1017005658 6:150026659-150026681 CCAGGTCCACCGATGGCACAGGG + Intergenic
1017853355 6:158325897-158325919 CCAGGACAACAGGTGGGGGGAGG - Intronic
1018850072 6:167580991-167581013 ACAGGACGACAGAGGGGACAAGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019444898 7:1066219-1066241 CCAGGCCCACAGAAGGGGACCGG + Intronic
1019625926 7:2015597-2015619 TCAGGCCCACACCTGGGGCAGGG - Intronic
1020822271 7:12985182-12985204 CCAGGACCACAGAAGGGTGAGGG - Intergenic
1021343224 7:19489547-19489569 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
1022417824 7:30193155-30193177 CCAGGAACTCAAATGGAGCATGG - Intergenic
1022469788 7:30675110-30675132 CCAGGAGAGCAGCTGGGGCAAGG - Intronic
1022504951 7:30903990-30904012 CCAAGAGCAGGGATGGGGCAGGG - Intergenic
1023684588 7:42721390-42721412 CCAGGATCACAGGTGGAGCCGGG - Intergenic
1024128297 7:46323396-46323418 CCAGGAGCCCAGGTGGGACAAGG + Intergenic
1024157567 7:46640295-46640317 GCAGAACCACGCATGGGGCAAGG + Intergenic
1024675250 7:51632277-51632299 CCAGGAACACAGCTGGAGCAGGG + Intergenic
1025812710 7:64885249-64885271 CCAGGACCACAGAGAGGGCTTGG - Intronic
1026205785 7:68255943-68255965 CCAGGAGCACTGATTGGTCAGGG + Intergenic
1028378994 7:90176929-90176951 CCAGGTCCACAGCTGTGGCTTGG + Intronic
1028709848 7:93894290-93894312 CTATGACCACAGATGGAGAAAGG + Intronic
1029611809 7:101630601-101630623 CCAGGCTCACAGACCGGGCATGG - Intergenic
1030205950 7:106952960-106952982 CCACGGCCACAGCTGGGCCATGG - Intergenic
1033628922 7:143138619-143138641 AGAGGAGCACAGATGGGGCTTGG + Intronic
1034275193 7:149820934-149820956 CCAGGGCCACAGCTGGGCCCCGG + Intergenic
1034932001 7:155169967-155169989 CGAGGACCACGGATGGGGACTGG - Intergenic
1035797366 8:2370678-2370700 ACAAGACCACAGATGGAGAAGGG - Intergenic
1036443843 8:8804783-8804805 CCAGGCCCACACACTGGGCACGG + Intronic
1036658024 8:10690387-10690409 CCAGGAGCACAAAGGGGGCAGGG + Intronic
1036692341 8:10951835-10951857 CCCGGACCAAGGAGGGGGCAGGG + Intronic
1036741252 8:11363757-11363779 TCAGGACCACAGATGTGGGAAGG - Intergenic
1037209090 8:16363211-16363233 CCAGGAACACAGGTGGGATAAGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1045837390 8:106538086-106538108 CCAGGACCACACATTTGGCTAGG - Intronic
1046687152 8:117240130-117240152 CCAGGACCACAGGTGGCACCAGG + Intergenic
1047206024 8:122803425-122803447 CCTGGTCTAGAGATGGGGCAGGG - Intronic
1047752469 8:127892082-127892104 CCAAGACCACAGTTGGGGCGGGG + Intergenic
1048057881 8:130886017-130886039 CCAGGACCACAGCTGGAGTCAGG + Intronic
1048294742 8:133206052-133206074 ACAGCACCACAGGTGCGGCATGG + Intronic
1048310728 8:133320655-133320677 CCACCACCACCGAGGGGGCAGGG - Intergenic
1048412285 8:134187603-134187625 CCAGTCCCACAGAAGGAGCAGGG + Intergenic
1048945818 8:139446071-139446093 TCAGGAAACCAGATGGGGCAGGG + Intergenic
1049161811 8:141102882-141102904 CCAGGAGCACTGAAGGGGCCTGG - Intergenic
1049613566 8:143566975-143566997 CCAGGCCCAAGGTTGGGGCATGG + Exonic
1050004906 9:1119790-1119812 GCAGGACCACAGGTGAGCCAAGG - Intergenic
1051351450 9:16201605-16201627 CCAGGAACATAGTTTGGGCAAGG - Intergenic
1051820133 9:21155199-21155221 CCAGGATCACAGATGTGTCCTGG + Intergenic
1052116107 9:24649825-24649847 CCAGGCACACAGCTGTGGCAGGG - Intergenic
1052376260 9:27721157-27721179 CCAGGAACACAGATGTAGGAGGG + Intergenic
1057193080 9:93098001-93098023 GCAGGACCCCAGTTGGTGCATGG - Intronic
1057216551 9:93231855-93231877 CCAGGAGCACACCTGGGGCCAGG - Intronic
1057217265 9:93236011-93236033 CCAGGCCCACAGGTGAGTCAAGG - Intronic
1057807467 9:98230054-98230076 CCAGAAGCACAGCTGGGTCAGGG - Intronic
1060187961 9:121575352-121575374 CCAGGACCACAGAAGAAGGAAGG - Intronic
1060215398 9:121735872-121735894 CCAGGCCAGCAGGTGGGGCAGGG + Intronic
1060547961 9:124471663-124471685 CTATGACCACAGATGGGTCCTGG + Intronic
1060691839 9:125668814-125668836 CTAGGCCCACTAATGGGGCAAGG + Intronic
1060734656 9:126059301-126059323 CGAGGAACAGAGATGGGCCAAGG - Intergenic
1061225794 9:129280420-129280442 AGAGGACCACGGGTGGGGCAGGG - Intergenic
1061403770 9:130382674-130382696 CCAGGATCACAGGTGGGGCTGGG - Intronic
1061429909 9:130524262-130524284 CCAGGACCAGAGAAAGGGAACGG - Intergenic
1061579846 9:131530205-131530227 CCAGGATCACAGTTGTGGCAGGG + Intronic
1062277592 9:135738061-135738083 GCAGGAACAGGGATGGGGCAAGG - Intronic
1062371574 9:136241880-136241902 CCAGGGCCACAGAGGGCGCACGG + Intronic
1187227316 X:17386038-17386060 CCAGCAATACAGTTGGGGCAGGG - Intronic
1188031366 X:25267906-25267928 CCAGAAGCACAGACGGGGGAAGG - Intergenic
1188266981 X:28088885-28088907 CAAGTGCCACAGATGGGACAGGG - Intergenic
1190713150 X:53083535-53083557 ACTGGACCACAGATGGGAAAGGG + Intronic
1192496976 X:71622699-71622721 CCTTGACCACAGGTGGGGCCCGG - Intergenic
1192833806 X:74778302-74778324 CAAGCCCCACAGAAGGGGCAAGG - Intronic
1193509778 X:82384553-82384575 CCAGAACCACAGCTGTGGCAGGG + Intergenic
1194694712 X:97031762-97031784 GCAGGACCACAGAGGGGAGAAGG + Intronic
1197553086 X:127918792-127918814 CCTGGACAGCAGATGTGGCATGG - Intergenic
1199984262 X:152939044-152939066 GGAGGGCCACAGATGGAGCAGGG + Intronic
1200058919 X:153475336-153475358 ACAGGACCCCAAATGGGACAAGG - Intronic
1200088999 X:153625704-153625726 GCAGGACCACAGCTGTGGGACGG - Intergenic
1201711872 Y:17001158-17001180 CAAGGAGTACAGATAGGGCATGG + Intergenic
1202583724 Y:26404879-26404901 CCAGGGCAGCAGAAGGGGCAGGG + Intergenic