ID: 1131073441

View in Genome Browser
Species Human (GRCh38)
Location 15:89480097-89480119
Sequence TGGCTGCCAGTTCTTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131073441_1131073452 13 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073452 15:89480133-89480155 GTGGGGATCAGGTCTGATCATGG 0: 1
1: 0
2: 1
3: 11
4: 141
1131073441_1131073447 -4 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073447 15:89480116-89480138 GCCATGCACCATACCACGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1131073441_1131073453 16 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073441_1131073449 2 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073449 15:89480122-89480144 CACCATACCACGTGGGGATCAGG 0: 1
1: 0
2: 0
3: 2
4: 55
1131073441_1131073446 -5 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1131073441_1131073445 -6 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131073441 Original CRISPR TGGCTGCCAGTTCTTTTTGG GGG (reversed) Intronic