ID: 1131073442

View in Genome Browser
Species Human (GRCh38)
Location 15:89480098-89480120
Sequence ATGGCTGCCAGTTCTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131073442_1131073449 1 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073449 15:89480122-89480144 CACCATACCACGTGGGGATCAGG 0: 1
1: 0
2: 0
3: 2
4: 55
1131073442_1131073445 -7 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559
1131073442_1131073446 -6 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1131073442_1131073447 -5 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073447 15:89480116-89480138 GCCATGCACCATACCACGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1131073442_1131073453 15 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073442_1131073452 12 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073452 15:89480133-89480155 GTGGGGATCAGGTCTGATCATGG 0: 1
1: 0
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131073442 Original CRISPR ATGGCTGCCAGTTCTTTTTG GGG (reversed) Intronic