ID: 1131073443

View in Genome Browser
Species Human (GRCh38)
Location 15:89480099-89480121
Sequence CATGGCTGCCAGTTCTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131073443_1131073446 -7 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1131073443_1131073453 14 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073443_1131073449 0 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073449 15:89480122-89480144 CACCATACCACGTGGGGATCAGG 0: 1
1: 0
2: 0
3: 2
4: 55
1131073443_1131073447 -6 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073447 15:89480116-89480138 GCCATGCACCATACCACGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1131073443_1131073454 30 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073454 15:89480152-89480174 ATGGTGGCCTTCACCCATCATGG 0: 2
1: 0
2: 1
3: 8
4: 90
1131073443_1131073445 -8 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559
1131073443_1131073452 11 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073452 15:89480133-89480155 GTGGGGATCAGGTCTGATCATGG 0: 1
1: 0
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131073443 Original CRISPR CATGGCTGCCAGTTCTTTTT GGG (reversed) Intronic