ID: 1131073445

View in Genome Browser
Species Human (GRCh38)
Location 15:89480114-89480136
Sequence CAGCCATGCACCATACCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 559}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131073441_1131073445 -6 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559
1131073444_1131073445 -9 Left 1131073444 15:89480100-89480122 CCAAAAAGAACTGGCAGCCATGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559
1131073439_1131073445 -1 Left 1131073439 15:89480092-89480114 CCCTTCCCCCAAAAAGAACTGGC 0: 1
1: 0
2: 3
3: 23
4: 216
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559
1131073440_1131073445 -2 Left 1131073440 15:89480093-89480115 CCTTCCCCCAAAAAGAACTGGCA 0: 1
1: 0
2: 0
3: 23
4: 255
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559
1131073443_1131073445 -8 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559
1131073442_1131073445 -7 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073445 15:89480114-89480136 CAGCCATGCACCATACCACGTGG 0: 1
1: 0
2: 0
3: 23
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131073445 Original CRISPR CAGCCATGCACCATACCACG TGG Intronic