ID: 1131073446

View in Genome Browser
Species Human (GRCh38)
Location 15:89480115-89480137
Sequence AGCCATGCACCATACCACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131073440_1131073446 -1 Left 1131073440 15:89480093-89480115 CCTTCCCCCAAAAAGAACTGGCA 0: 1
1: 0
2: 0
3: 23
4: 255
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1131073439_1131073446 0 Left 1131073439 15:89480092-89480114 CCCTTCCCCCAAAAAGAACTGGC 0: 1
1: 0
2: 3
3: 23
4: 216
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1131073444_1131073446 -8 Left 1131073444 15:89480100-89480122 CCAAAAAGAACTGGCAGCCATGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1131073443_1131073446 -7 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1131073441_1131073446 -5 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1131073442_1131073446 -6 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073446 15:89480115-89480137 AGCCATGCACCATACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131073446 Original CRISPR AGCCATGCACCATACCACGT GGG Intronic