ID: 1131073453

View in Genome Browser
Species Human (GRCh38)
Location 15:89480136-89480158
Sequence GGGATCAGGTCTGATCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131073439_1131073453 21 Left 1131073439 15:89480092-89480114 CCCTTCCCCCAAAAAGAACTGGC 0: 1
1: 0
2: 3
3: 23
4: 216
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073441_1131073453 16 Left 1131073441 15:89480097-89480119 CCCCCAAAAAGAACTGGCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 134
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073442_1131073453 15 Left 1131073442 15:89480098-89480120 CCCCAAAAAGAACTGGCAGCCAT 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073443_1131073453 14 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073440_1131073453 20 Left 1131073440 15:89480093-89480115 CCTTCCCCCAAAAAGAACTGGCA 0: 1
1: 0
2: 0
3: 23
4: 255
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073444_1131073453 13 Left 1131073444 15:89480100-89480122 CCAAAAAGAACTGGCAGCCATGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201
1131073448_1131073453 -4 Left 1131073448 15:89480117-89480139 CCATGCACCATACCACGTGGGGA 0: 1
1: 0
2: 2
3: 2
4: 66
Right 1131073453 15:89480136-89480158 GGGATCAGGTCTGATCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131073453 Original CRISPR GGGATCAGGTCTGATCATGG TGG Intronic