ID: 1131073454

View in Genome Browser
Species Human (GRCh38)
Location 15:89480152-89480174
Sequence ATGGTGGCCTTCACCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131073444_1131073454 29 Left 1131073444 15:89480100-89480122 CCAAAAAGAACTGGCAGCCATGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1131073454 15:89480152-89480174 ATGGTGGCCTTCACCCATCATGG 0: 2
1: 0
2: 1
3: 8
4: 90
1131073450_1131073454 5 Left 1131073450 15:89480124-89480146 CCATACCACGTGGGGATCAGGTC 0: 1
1: 0
2: 0
3: 7
4: 40
Right 1131073454 15:89480152-89480174 ATGGTGGCCTTCACCCATCATGG 0: 2
1: 0
2: 1
3: 8
4: 90
1131073443_1131073454 30 Left 1131073443 15:89480099-89480121 CCCAAAAAGAACTGGCAGCCATG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1131073454 15:89480152-89480174 ATGGTGGCCTTCACCCATCATGG 0: 2
1: 0
2: 1
3: 8
4: 90
1131073451_1131073454 0 Left 1131073451 15:89480129-89480151 CCACGTGGGGATCAGGTCTGATC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1131073454 15:89480152-89480174 ATGGTGGCCTTCACCCATCATGG 0: 2
1: 0
2: 1
3: 8
4: 90
1131073448_1131073454 12 Left 1131073448 15:89480117-89480139 CCATGCACCATACCACGTGGGGA 0: 1
1: 0
2: 2
3: 2
4: 66
Right 1131073454 15:89480152-89480174 ATGGTGGCCTTCACCCATCATGG 0: 2
1: 0
2: 1
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131073454 Original CRISPR ATGGTGGCCTTCACCCATCA TGG Intronic