ID: 1131075078

View in Genome Browser
Species Human (GRCh38)
Location 15:89490346-89490368
Sequence GACCCACAGCTCTCCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131075078_1131075086 23 Left 1131075078 15:89490346-89490368 CCAGTGTGGGAGAGCTGTGGGTC 0: 1
1: 0
2: 0
3: 30
4: 182
Right 1131075086 15:89490392-89490414 CTTCCCTCTGAATTTAGCATCGG 0: 1
1: 0
2: 0
3: 11
4: 175
1131075078_1131075081 -9 Left 1131075078 15:89490346-89490368 CCAGTGTGGGAGAGCTGTGGGTC 0: 1
1: 0
2: 0
3: 30
4: 182
Right 1131075081 15:89490360-89490382 CTGTGGGTCCTGCCCCAGGGTGG 0: 1
1: 1
2: 4
3: 44
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131075078 Original CRISPR GACCCACAGCTCTCCCACAC TGG (reversed) Intronic
902322387 1:15677262-15677284 GACACACAACTCTCCCTCCCAGG + Intergenic
902607086 1:17574789-17574811 GGCCCACGGCTCCCCCACGCAGG - Intronic
903153923 1:21431203-21431225 CACCCTCAGGTCTCCTACACTGG + Intergenic
903559998 1:24220109-24220131 GTGCCACAGCACTCCCGCACAGG + Intergenic
903780739 1:25818634-25818656 GCCCCACAGCTCTTCCACTGTGG - Intronic
904487164 1:30833600-30833622 GACCCACAGAGGTCCCACGCTGG - Intergenic
905626525 1:39493195-39493217 GCCCCACAGCTCCCCCACTTCGG - Intronic
905962002 1:42050794-42050816 GACCCCCAGCTCGGCCACTCAGG + Intergenic
906216396 1:44043449-44043471 GCCCCACACCTCTCCCAACCTGG - Intergenic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
912023450 1:105137777-105137799 GATGGACAGCTCTCCCTCACAGG + Intergenic
912778511 1:112522670-112522692 CACCCTAAACTCTCCCACACAGG - Intronic
919349602 1:196432389-196432411 CATCTCCAGCTCTCCCACACTGG - Intronic
922894322 1:229088608-229088630 TACACACAGCTCTGCCGCACAGG + Intergenic
1062919906 10:1271890-1271912 GACCCTCAGTTCTGCCACTCAGG + Intronic
1063002314 10:1936057-1936079 GACCCACCACTCTACAACACTGG + Intergenic
1063416216 10:5874578-5874600 GACCCCCAGCTTTCCAACACAGG + Intronic
1063608944 10:7546828-7546850 CACCCGCTGCTCTCCCACGCTGG - Intergenic
1065025449 10:21535292-21535314 GACCCCCAGCCTCCCCACACTGG - Intronic
1067054308 10:43042207-43042229 GACCCCCATCTCTCCCTCACGGG - Intergenic
1067346283 10:45441260-45441282 GACCCGCAGCTCCCCCACCCAGG - Intronic
1068570067 10:58618189-58618211 GACACACAGCTCCAACACACAGG - Intronic
1068593357 10:58874066-58874088 GACCAACGGCTCTCCCCCAAGGG + Intergenic
1069065009 10:63933251-63933273 GAGCCACTGCTATCCCATACAGG - Intergenic
1070288732 10:75101124-75101146 GACCCACAGCTGTTCCCCACTGG - Intronic
1070811932 10:79302446-79302468 GACTGCCAGCTCTTCCACACAGG - Intronic
1074146953 10:110725345-110725367 GACCTACAGGTCCCCCACAAGGG - Intronic
1075382484 10:122030689-122030711 GACCCAGACCTCTGCCAGACTGG - Intronic
1076542888 10:131225295-131225317 GACGCACAGCCCTGCCACACAGG + Intronic
1077199504 11:1298433-1298455 GACCCACAGTGCTCCCTCAGAGG - Intronic
1082278530 11:50246518-50246540 GCCCCCCAGCCCTCCCAGACTGG + Intergenic
1082804106 11:57436346-57436368 GACCCACACCTCTCCTGCTCCGG - Intergenic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1084617826 11:70248051-70248073 GGCCCTCAGATCTGCCACACTGG - Intergenic
1084809620 11:71604241-71604263 GACACACAGCTAGCACACACGGG + Intergenic
1088005978 11:104941067-104941089 TACCCATAGCCCTCCCACCCTGG + Intergenic
1089759856 11:120715362-120715384 GACCCACCGCTTTCCGACAACGG - Intronic
1091738145 12:2940392-2940414 AGTCCACAGCTCTGCCACACGGG - Intronic
1092915117 12:13182531-13182553 GAGCCACTGCCCTCCCACCCAGG - Intergenic
1095141594 12:38669886-38669908 GACACACAACTCTCCCTCCCAGG + Intronic
1096694003 12:53337452-53337474 CACCGGCAGCTCTCCCACAGGGG + Intronic
1106034454 13:26031138-26031160 GACCATCAGTTCTCCCAGACAGG - Intergenic
1106126143 13:26901409-26901431 GACTCTCAGCCCTCCCACACTGG - Intergenic
1106309792 13:28544143-28544165 CATCCTCTGCTCTCCCACACTGG - Intergenic
1108156682 13:47592380-47592402 GGCCTACAGCTCTCCCAAGCTGG + Intergenic
1108811664 13:54232473-54232495 GTCCCATAGCGCTCCAACACAGG - Intergenic
1110486919 13:76056730-76056752 GACCCACAGCTATATCATACTGG + Intergenic
1111277797 13:85973897-85973919 GACCTTCATCTCTCACACACTGG + Intergenic
1113597127 13:111541051-111541073 GCCTCAGAGCTCTCCCACCCGGG - Intergenic
1113890496 13:113732781-113732803 GAGCCACCGCTCACCCACGCGGG - Intronic
1113969265 13:114176487-114176509 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969284 13:114176566-114176588 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969334 13:114176778-114176800 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969399 13:114177084-114177106 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969418 13:114177163-114177185 CACCCACAGCTGTCACCCACAGG - Intergenic
1114736576 14:25049470-25049492 GACCCCGAGCTCCCCCACACTGG + Intronic
1115027662 14:28762819-28762841 GTCCCCCAGCTCTCCCAAAGAGG - Intergenic
1117942874 14:60987739-60987761 AACCCACAGCTCCCCTCCACTGG + Intronic
1118388792 14:65279676-65279698 GACCGACAGCTCTCCCAACCAGG + Intergenic
1118455947 14:65945903-65945925 GAACCACAGCTCTCACCCCCAGG - Intergenic
1123139451 14:106061215-106061237 TACCCAGAGCTCACCCACAATGG + Intergenic
1124606943 15:31176442-31176464 GGCCCACAGATCTTCCACTCCGG + Intergenic
1124644277 15:31425546-31425568 GGCCCACAGATCTTCCACACTGG - Intronic
1125965713 15:43874155-43874177 GGCCCTCAGCTCTCCCCCAAGGG + Exonic
1125967255 15:43884365-43884387 GTCCCACAGCCCTGCCACACTGG - Intronic
1127574931 15:60282266-60282288 GCCCCACAGCCCTCACACAGTGG - Intergenic
1128838597 15:70831477-70831499 CACCCACAGCTCTGTCAGACAGG + Exonic
1131075078 15:89490346-89490368 GACCCACAGCTCTCCCACACTGG - Intronic
1131094209 15:89645728-89645750 GCCCCACAGCTCTCCCCCAGGGG + Intronic
1131296802 15:91156395-91156417 GAGTCACACCTCTCCGACACTGG - Intronic
1133015603 16:2938122-2938144 GACCCCCAGCCCTGCCACCCAGG + Intronic
1133387205 16:5379413-5379435 GAGCCACAGCTCTCCACCCCAGG - Intergenic
1135675950 16:24415132-24415154 GACACACAGCTGGCCCACACAGG + Intergenic
1135976792 16:27113709-27113731 GGCCCACAGCTCTCACCCAAGGG - Intergenic
1139089969 16:63633824-63633846 GACACACAACTCTCCCTCCCAGG - Intergenic
1141726230 16:85790695-85790717 GACCCACATCTCTGCCCCCCGGG + Intronic
1142169203 16:88611688-88611710 AACCCAGAGCTCTCCAACGCAGG + Intronic
1143295119 17:5865322-5865344 GACCCAGAGCTCTCTGACCCTGG - Intronic
1143653507 17:8279116-8279138 GCCCCACTGCTCTCCCAACCAGG - Intergenic
1147421470 17:40324045-40324067 GAAGCACAGCTCTCTCACAATGG - Intronic
1147549385 17:41428691-41428713 GAGCCACAGCTGACCCACAGTGG - Intergenic
1147586842 17:41657762-41657784 GCCCCTCAGGCCTCCCACACAGG + Intergenic
1149091551 17:52789161-52789183 CACCCTCTGCTCTCACACACTGG + Intergenic
1151190270 17:72393161-72393183 GACCACCAGCTCTCTCTCACAGG + Intergenic
1151335988 17:73440019-73440041 GGCCCTCACCTCTCCCACACAGG - Intronic
1151714601 17:75824998-75825020 GACCCCCAGCACTCCCCCTCGGG - Exonic
1152849968 17:82627721-82627743 GACCCACTGGCCTCGCACACAGG + Intronic
1155994265 18:32313262-32313284 GACCCACTTCCCTCCCACCCAGG - Intronic
1159161823 18:64651884-64651906 CACACACACCTCTTCCACACTGG + Intergenic
1160241782 18:77130188-77130210 TACCCAGAGATGTCCCACACAGG - Intronic
1160765158 19:804414-804436 GACCGACAGCTCTCCCAACCAGG + Exonic
1161061971 19:2219789-2219811 AACCCACAGCCCGCCCTCACCGG - Intronic
1161330333 19:3683873-3683895 GTCCCACACCTCCCCCACACTGG + Intronic
1165344090 19:35232741-35232763 AACCCTCAGCCCTCCCAGACTGG - Intergenic
927508857 2:23631860-23631882 GACCCAAAACTCTCCCAATCAGG + Intronic
927810385 2:26177274-26177296 GACTCCCATCCCTCCCACACAGG - Intronic
929942061 2:46341789-46341811 GACCCACGGCTCTGCAAAACTGG + Intronic
930019918 2:46995242-46995264 GCCCCACAGCCCTTCCCCACAGG - Intronic
931516952 2:63055591-63055613 GAGCCCGAGCTCTCCCGCACTGG - Exonic
933969024 2:87455247-87455269 GACCCAGGGGTCGCCCACACAGG - Intergenic
934991182 2:98922660-98922682 GACACCTAGCTCTCCCTCACAGG + Intronic
935765175 2:106359557-106359579 GACCTACAGCCCTCCCACTGAGG + Intergenic
936110375 2:109659820-109659842 GACCATCAGCCCTCCCAGACTGG - Intergenic
936324767 2:111495260-111495282 GACCCAGGGGTCGCCCACACAGG + Intergenic
937346183 2:121127032-121127054 GACCCACTGCTCACCCAGTCTGG + Intergenic
938062898 2:128266472-128266494 CACCCTCAGGTCTCCTACACTGG - Exonic
946409986 2:219511028-219511050 CGCCCACATCTGTCCCACACTGG + Intergenic
947605771 2:231484142-231484164 CACCCACAGCGCCCCCACGCTGG - Intergenic
947714985 2:232334876-232334898 GACGCCCAGCTCTCCCACCTGGG + Intronic
947734061 2:232445827-232445849 GACGCCCAGCTCTCCCACCTGGG + Intergenic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
948721504 2:239903862-239903884 GTCCCACAGCTCTTCCATGCAGG + Intronic
1169109506 20:3022820-3022842 GACCCACAGATCACTCACATCGG - Exonic
1169334957 20:4748517-4748539 GACCAACAGCCCTGCCTCACAGG + Intergenic
1170320695 20:15094901-15094923 GACCCAGATCTCTCCCTCCCAGG - Intronic
1172882948 20:38213467-38213489 GACCCACAGCTCTTGCCCAGAGG - Exonic
1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG + Intronic
1173162501 20:40663250-40663272 CACACACTGCTCTCCCACAGGGG + Intergenic
1175108754 20:56631283-56631305 GCGCCACCCCTCTCCCACACTGG + Exonic
1180660263 22:17460991-17461013 GACACACAGCACCCCCAAACAGG - Intronic
1181681288 22:24497512-24497534 GGCCCCCACCTCTCCCACCCAGG - Intronic
1184093004 22:42302117-42302139 GCCCCTCAGCTCTCCCAGACTGG - Intronic
1184231265 22:43159549-43159571 GGCCCACAGCTTCCCCACCCTGG - Intronic
1185256907 22:49838938-49838960 GCCCCACAGCCCTCCCATAGGGG + Intergenic
950473759 3:13203234-13203256 CACACACAACTCACCCACACAGG + Intergenic
951958355 3:28284386-28284408 GATCCTCATCTCTCACACACAGG + Intronic
952853698 3:37750453-37750475 CACCCACAGGTCTACAACACTGG + Exonic
952917158 3:38255517-38255539 AACCCACAGCTCTCCGCCAACGG - Intergenic
953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG + Intergenic
958051555 3:88353921-88353943 GACCCAAACACCTCCCACACTGG - Intergenic
961792823 3:129388873-129388895 GAGCCACAACTCTGCCAAACGGG + Intergenic
961806741 3:129495065-129495087 GAGCCACAACTCTGCCAAACGGG + Intronic
962919219 3:139935758-139935780 CACCCACTGCGCTCCCACCCCGG - Intronic
963399679 3:144782056-144782078 GACTCTCAACTCTGCCACACTGG - Intergenic
964739556 3:159951162-159951184 AAAACACAGCTCTCCCAGACAGG - Intergenic
968118621 3:196108706-196108728 AACCCACAGCAGTCCCACTCGGG + Intergenic
968476904 4:814934-814956 GACTGCCAGCTCTCACACACTGG + Intronic
968490374 4:886996-887018 GGCACACAGCTCACACACACAGG + Intronic
968490380 4:887067-887089 GGCACACAGCTCACACACACAGG + Intronic
968602621 4:1517471-1517493 GACCCACAGAGCTCCCACCAGGG + Intergenic
968982331 4:3856995-3857017 GGCCCACAGCTCTCCCAGGCAGG + Intergenic
969262525 4:6043066-6043088 TCCCCACAGCCCTCCCCCACAGG - Intronic
969300772 4:6295674-6295696 CACCCACCACGCTCCCACACTGG - Intronic
974365661 4:60945871-60945893 GCCATACAGCTCTCCCAGACTGG + Intergenic
975241668 4:72066870-72066892 TGCCTACAGCTCTCCCAGACTGG + Intronic
982014235 4:151137106-151137128 TACACACAGCTCTCACACATAGG + Intronic
985126904 4:186703590-186703612 GAGCCACAGCACTCCTGCACAGG + Intronic
985390844 4:189490714-189490736 CAGCCACAGCCCACCCACACCGG - Intergenic
987250142 5:16091982-16092004 TAGCCAGAGCTCTTCCACACAGG - Intronic
988499871 5:31775803-31775825 GTGCCAAAGGTCTCCCACACTGG + Intronic
989377013 5:40774760-40774782 TAGCTACAGCTCTCCCACAAAGG + Intronic
997878036 5:137566300-137566322 GCCACACTCCTCTCCCACACAGG + Intronic
998132106 5:139656388-139656410 GATCCCCAGGTCTCTCACACAGG + Intronic
998953201 5:147412650-147412672 GGCCCCCAGCTCTCCCAGGCAGG + Exonic
999270550 5:150294259-150294281 GTCCCTGAGGTCTCCCACACAGG + Intergenic
1002259486 5:177983863-177983885 GGCCCACGGCTCTCCAAGACTGG - Intergenic
1002649275 5:180679871-180679893 GACACACAACTCTCCCTCCCAGG + Intergenic
1002702132 5:181131564-181131586 CTCCCACTCCTCTCCCACACCGG + Intergenic
1003389786 6:5703799-5703821 ATCCCAGAGCTCTCCCACAGAGG + Intronic
1003864637 6:10351792-10351814 GACCCACTGAGCTCCCACAGGGG - Intergenic
1006437255 6:34032539-34032561 GACATACACCTCTCCCACTCTGG - Intronic
1006440065 6:34048425-34048447 GGGGCTCAGCTCTCCCACACAGG + Intronic
1008520229 6:52356100-52356122 GACCCCCAGCTGTCCAACAGAGG + Intergenic
1018358141 6:163039268-163039290 GACTCACAGTTCTCCATCACTGG - Intronic
1019329651 7:456082-456104 GACCCCCAGATCTCCCACTCCGG + Intergenic
1019329707 7:456225-456247 GACCCCCAGGTCTCCCACTCCGG + Intergenic
1019329815 7:456510-456532 GACCCCCAGATCTCCCACCCTGG + Intergenic
1019329992 7:456966-456988 GACCCCCAGATCTCCCACCCTGG + Intergenic
1019330049 7:457109-457131 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019330136 7:457310-457332 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019330191 7:457440-457462 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019330262 7:457612-457634 GACCCCTAGATCTCCCACCCTGG + Intergenic
1019443046 7:1056981-1057003 GACCCACAGGTCACCCTCCCTGG + Intronic
1020100659 7:5392653-5392675 AAAAAACAGCTCTCCCACACAGG + Intronic
1021783548 7:24130265-24130287 CACCCACACCTCTCCCACCATGG + Intergenic
1022453049 7:30533806-30533828 AACACACAGCTCTCCCTGACAGG + Intronic
1023793119 7:43769648-43769670 GAGCCACTGCACTCCCAGACTGG - Intronic
1028233831 7:88336732-88336754 GAACCACACCTCACCCACAGAGG - Intergenic
1030092380 7:105868930-105868952 GAGCCACATTTCTTCCACACGGG + Intronic
1032977130 7:137238311-137238333 AACCCAGAGCTCTCCCAGGCTGG - Intronic
1033430807 7:141288067-141288089 GGCACACAGCTCTGCCACAGGGG - Intronic
1035185109 7:157120325-157120347 GGCACACGGCCCTCCCACACAGG - Intergenic
1035308923 7:157952564-157952586 GACCCACAGCTCTGCACCACAGG - Intronic
1035823509 8:2620150-2620172 CACCCACATCCCTCTCACACAGG - Intergenic
1036029510 8:4952160-4952182 CACACACACCTCTCCTACACAGG + Intronic
1036166720 8:6441700-6441722 TACCTACTGCTCTCCCTCACTGG + Intronic
1037303581 8:17480932-17480954 TTCCCACAGCTCTCCAACGCAGG - Intergenic
1038180025 8:25218744-25218766 GAGCCACAGCACTGCCACAGAGG - Intronic
1039482144 8:37882125-37882147 TCTCCACAGCTCTTCCACACGGG + Intronic
1040385974 8:46915404-46915426 AACCCACAGCTCTCCCACCAGGG - Intergenic
1040776125 8:51045072-51045094 GACCCAATGCTCTTCCACAGTGG + Intergenic
1041243877 8:55872720-55872742 GACCCACATCTAGCTCACACAGG - Intergenic
1041348944 8:56929694-56929716 GACCCTCAGTTCACCCTCACAGG + Intergenic
1042746919 8:72118668-72118690 GACCCACTGCTCTGACCCACAGG + Intergenic
1048571065 8:135657185-135657207 GAGCCACCGCTCTAACACACAGG - Intergenic
1049392239 8:142377982-142378004 GTCACACAGCCATCCCACACAGG + Intronic
1049654569 8:143791980-143792002 GACCCACAGACCTTCCACAGGGG + Exonic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1053144572 9:35703900-35703922 GAGCCAACGCTTTCCCACACAGG - Exonic
1056652731 9:88482093-88482115 GACACACTGCTCTCCCCTACAGG - Intergenic
1057037848 9:91824748-91824770 CACACACAGCTCTCCCAGGCGGG + Intronic
1059363545 9:113767292-113767314 GTCCCCCAGATCACCCACACAGG - Intergenic
1061025854 9:128048946-128048968 GACCCAGAGCTGGCCCACAAGGG - Intergenic
1061388740 9:130305632-130305654 CAACCACAGCCCTCCCACACTGG - Intronic
1061834019 9:133317424-133317446 GCCCCCCAGCCATCCCACACGGG - Intergenic
1062363687 9:136199110-136199132 GACCCCCAGCCCTCCCACCCCGG + Intronic
1190597360 X:52062689-52062711 GACACAGAGCTACCCCACACTGG + Intronic
1190611464 X:52191384-52191406 GACACAGAGCTACCCCACACTGG - Intronic
1192362474 X:70448456-70448478 GAACCACAGTTCTCCCTGACTGG - Intronic
1199758728 X:150889188-150889210 CACCCACAGTGCCCCCACACGGG + Intronic
1200098279 X:153674202-153674224 GCACCACAGCTCTGCCACCCTGG + Exonic
1200122677 X:153798534-153798556 GGCCCCCAGCTCTCCCAGTCGGG - Intergenic