ID: 1131075329

View in Genome Browser
Species Human (GRCh38)
Location 15:89491902-89491924
Sequence CTGCAGTGAGCACTGTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131075329_1131075332 1 Left 1131075329 15:89491902-89491924 CCCCTGGACAGTGCTCACTGCAG 0: 1
1: 0
2: 2
3: 31
4: 285
Right 1131075332 15:89491926-89491948 GCTTTGTAGCACACATGTAATGG 0: 1
1: 0
2: 0
3: 7
4: 116
1131075329_1131075333 30 Left 1131075329 15:89491902-89491924 CCCCTGGACAGTGCTCACTGCAG 0: 1
1: 0
2: 2
3: 31
4: 285
Right 1131075333 15:89491955-89491977 GCAATCAAAGCCCTATGCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131075329 Original CRISPR CTGCAGTGAGCACTGTCCAG GGG (reversed) Intronic
900805207 1:4763092-4763114 CTGCAGTGATATCTGTCCTGTGG + Intronic
900993655 1:6109046-6109068 CTGCAGGCAGCACTGCCAAGTGG + Intronic
901234822 1:7662081-7662103 CAGGAGGGAGCAGTGTCCAGAGG + Intronic
901440299 1:9273575-9273597 CTGTAGTGAGACCTCTCCAGGGG - Intergenic
902058882 1:13624822-13624844 CTGCAGTAAGCAGTGACCTGGGG - Intergenic
902721107 1:18304578-18304600 CTGCATTGAGCACTGTGGAATGG - Intronic
903779879 1:25814398-25814420 CAGCAGTGAGCATAGTCCTGAGG + Intronic
905408859 1:37754496-37754518 CTCCAGTCAGCACTGCCCCGTGG + Intronic
906046386 1:42834284-42834306 TTGCCCTGAGCACTGTCCACGGG - Intronic
908509154 1:64837401-64837423 CAGCCGGGAACACTGTCCAGGGG - Intronic
909369722 1:74870013-74870035 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
910273263 1:85420098-85420120 ATGCAGGGAGCAGTGTCCCGAGG + Intronic
912452819 1:109777698-109777720 CTGCAGTCCTCACTGTGCAGGGG - Intergenic
913553293 1:119937801-119937823 CTGCAGTATTGACTGTCCAGTGG - Intronic
913974907 1:143447961-143447983 CTGCAGTGTGCACAGTCAAGGGG - Intergenic
914069299 1:144273578-144273600 CTGCAGTGTGCACAGTCAAGGGG - Intergenic
914109856 1:144692776-144692798 CTGCAGTGTGCACAGTCAAGGGG + Intergenic
914983704 1:152438947-152438969 CTGCAGTGAGGACAATGCAGTGG + Intergenic
915314282 1:155019168-155019190 CTGCAAAGAAAACTGTCCAGTGG - Intronic
915934444 1:160082521-160082543 CTGCAGTCAGCACTCTGGAGAGG - Intronic
916518203 1:165539977-165539999 CTGCAGGATTCACTGTCCAGAGG - Intergenic
916951714 1:169787180-169787202 GTGCAGTGTGCAGTGTGCAGTGG + Intronic
917134942 1:171780796-171780818 CTGCAGTCTCCACTTTCCAGGGG - Intergenic
918207648 1:182323801-182323823 CTGCAGTGTACACTGGCCTGCGG - Intergenic
919270918 1:195343552-195343574 CTGCAGTGAGCACAAGCCACTGG - Intergenic
920080073 1:203366733-203366755 CTGCACTGACCACTGCCCAGAGG - Intergenic
920708761 1:208275172-208275194 CTGCATAGAGCTCTGTCAAGTGG - Intergenic
920899382 1:210091627-210091649 CTGCAGTGAGCCATGTTCACTGG + Intronic
923006669 1:230055368-230055390 GTGCAGTGCACACAGTCCAGAGG - Intergenic
923273996 1:232380872-232380894 CTGCAGTGAACATTGGCCAATGG + Intergenic
1063575574 10:7259295-7259317 TGGCAGTGGGCACTTTCCAGTGG - Intronic
1067272154 10:44801950-44801972 CTGCAGGTGCCACTGTCCAGAGG - Intergenic
1067553530 10:47252321-47252343 CTGCAGAGATCACTGCACAGTGG + Intergenic
1067757266 10:49014700-49014722 CTGCAGTGTGAACTCTGCAGAGG - Exonic
1069675948 10:70247847-70247869 CTTCAGTGACCACAGTGCAGGGG + Exonic
1070510656 10:77157849-77157871 CAGCAGTGAGCTCTGTCCTCTGG + Intronic
1070532866 10:77352687-77352709 CTGTAGTGAGCACTGGCCTATGG + Intronic
1072792276 10:98327011-98327033 CCCCAGAGACCACTGTCCAGCGG - Intergenic
1073132622 10:101199965-101199987 CTTCAGTCAGCTCTGTTCAGTGG - Intergenic
1073396694 10:103223881-103223903 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
1076384990 10:130049310-130049332 CTGGAGGGAACACTGTGCAGGGG + Intergenic
1076723752 10:132404093-132404115 CTGCAGGGAGCTTTCTCCAGGGG + Intronic
1076847017 10:133074358-133074380 CTACAGTGACCACGGACCAGGGG - Intronic
1076924753 10:133476769-133476791 CGGCAGGGAGCACTGTCCTCGGG + Intergenic
1079137035 11:17781241-17781263 CAGCGGTAAGCACTGTCCACAGG + Intronic
1079401976 11:20113044-20113066 CTGCAGAGAGGACTCTGCAGGGG - Intronic
1079872867 11:25822183-25822205 ATGCAGGGAGCATTGTCCTGAGG - Intergenic
1080909531 11:36581652-36581674 ATGCAGAGAGCAGTGTCCAAAGG + Intronic
1081633984 11:44708505-44708527 CTGCACTCAGACCTGTCCAGAGG + Intergenic
1082165500 11:48945581-48945603 CTTTAATGAGCACTGTCAAGAGG + Intergenic
1082169197 11:48981786-48981808 CTTTAATGAGCACTGTCAAGAGG - Intergenic
1085218566 11:74853103-74853125 CCTCAGAGAGCACTGTCTAGTGG + Intronic
1085482249 11:76832490-76832512 CTGCAGGGAGCACTTTCTGGAGG - Intergenic
1087223518 11:95572062-95572084 TTGCAGTCAGAACTGGCCAGGGG + Intergenic
1088314863 11:108497800-108497822 TTGCAGGGAGCGCTTTCCAGTGG - Intronic
1090879942 11:130824595-130824617 CTGCAGTAAGCAGTGTCGGGAGG + Intergenic
1091037098 11:132244159-132244181 CTACACTGAGCACTGATCAGCGG - Intronic
1093776612 12:23083138-23083160 CTTAAGTCAGCACTGTCCATAGG + Intergenic
1095960584 12:47832292-47832314 CTGCAGTCAGCCCTGTCCTCTGG - Intronic
1098559124 12:71852248-71852270 ATGCAGGGAGCAGTGTCCTGAGG + Intronic
1098957206 12:76699774-76699796 CTGCAGTGAGCTTTGATCAGAGG - Intergenic
1099186692 12:79522757-79522779 CAGGAGTGAGCACTGCCGAGAGG - Intergenic
1099587124 12:84532995-84533017 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
1100601265 12:96113445-96113467 CTCCAGTGACCATGGTCCAGCGG + Intergenic
1101736527 12:107467356-107467378 CTGCTGGGATCACTGGCCAGAGG - Intronic
1102024919 12:109709054-109709076 CAGCAGTAAGCACTGACGAGAGG + Intergenic
1103627144 12:122227809-122227831 CGCAAGTGAACACTGTCCAGTGG - Intronic
1104509284 12:129361344-129361366 CTGCAGTAAGCAGTAGCCAGTGG - Intronic
1105951062 13:25229877-25229899 GGGCAGTGAGCACTTTCCTGTGG - Intergenic
1107818274 13:44263747-44263769 CTGCAGATGGCACTGCCCAGAGG + Intergenic
1108911823 13:55563513-55563535 GTGCAGGCAGCACTTTCCAGAGG + Intergenic
1109003361 13:56835591-56835613 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
1109294422 13:60512923-60512945 CTCCACTGAGCAGTGCCCAGTGG + Intronic
1110331344 13:74276970-74276992 CTGCCGTGGGCATTGTCCAGAGG - Intergenic
1112434158 13:99379032-99379054 CTGCAGTGAGCACAAGCCACAGG + Intronic
1112524667 13:100133358-100133380 CTGCAGTAGACACTGTCAAGAGG - Intronic
1112864163 13:103872779-103872801 ATGCAGTGAGCCCTGTCCCTAGG + Intergenic
1113669472 13:112165880-112165902 CTGCTGTGAGCACGGGGCAGGGG - Intergenic
1113669486 13:112165954-112165976 CTGCAGTGAGGTCCTTCCAGTGG - Intergenic
1113946951 13:114049825-114049847 CTCCAGGAAGCTCTGTCCAGTGG + Intronic
1115134350 14:30091037-30091059 ATGCAGGGAGCAGTGTCCCGAGG + Intronic
1116706402 14:48307791-48307813 CTGCAGTTACCACTATCCAAGGG - Intergenic
1117445612 14:55801094-55801116 CTTAGGTGAGCACTGTGCAGAGG + Intergenic
1117575923 14:57097232-57097254 CTGGAGAGAGCACTCCCCAGTGG - Intergenic
1119166381 14:72498349-72498371 CTGCTCTGAGCAGTGACCAGAGG - Intronic
1119890631 14:78179534-78179556 CTGGAGTCAGCATTCTCCAGTGG + Intergenic
1120740760 14:88106309-88106331 CTGCAGTTACCACTGCCAAGGGG - Intergenic
1121140757 14:91539527-91539549 ATGCAGGGAGCAGTGTTCAGAGG + Intergenic
1122068924 14:99192816-99192838 CTCTATTGAGCACTGACCAGAGG - Intronic
1122392970 14:101403063-101403085 CTGCAGTCAGCATTGCACAGTGG - Intergenic
1123412555 15:20072664-20072686 CGGCAGGGAGCAGTGTCCTGTGG - Intergenic
1123521897 15:21079777-21079799 CGGCAGGGAGCAGTGTCCTGTGG - Intergenic
1124209666 15:27752758-27752780 ATGCAGGGAGCTGTGTCCAGAGG - Intergenic
1124239060 15:28015060-28015082 GAGCAGTGAGCACAGGCCAGCGG + Intronic
1127861845 15:63000252-63000274 TTGCAGTAAACAATGTCCAGTGG - Intergenic
1128705524 15:69835110-69835132 CCCAAGTGAGCACTGACCAGGGG - Intergenic
1129198929 15:73987117-73987139 CTGCAGAGAGCAATGAGCAGTGG + Intronic
1130108546 15:80946852-80946874 CTGGAGTTAGCAGTGCCCAGAGG - Intronic
1131075329 15:89491902-89491924 CTGCAGTGAGCACTGTCCAGGGG - Intronic
1131594558 15:93784056-93784078 CTGCAGTGATCACTTCCCAGAGG + Intergenic
1131947935 15:97648393-97648415 CTGCAGTGTGCACTGTTTAATGG + Intergenic
1132425083 15:101709384-101709406 AGGGAGTGAGCACTGACCAGGGG - Intronic
1132608307 16:802622-802644 CTGGAGTGAGCACTGCCCTGTGG + Intergenic
1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG + Exonic
1133784055 16:8961937-8961959 CTGCAGTAGGCACTCCCCAGTGG - Intronic
1134530507 16:14979265-14979287 CAGCTCTTAGCACTGTCCAGTGG - Intronic
1135069118 16:19337064-19337086 CAGCATTGAGCAGTGCCCAGAGG - Intergenic
1136235583 16:28911601-28911623 TTGCAGTGAGCAGTGAGCAGAGG + Intronic
1138874111 16:60928444-60928466 CTGCAGTGACAACTGTGCAAGGG - Intergenic
1139865838 16:70061702-70061724 CAGCTCTTAGCACTGTCCAGTGG + Intergenic
1141097475 16:81172979-81173001 CTGCCGTGAGCAGGATCCAGGGG - Intergenic
1141377654 16:83546806-83546828 CTGCAGTGCCCTCTGTCTAGTGG - Intronic
1143052217 17:4135580-4135602 CTGCTGTCAGAACTGTCCAGAGG - Intronic
1143280795 17:5752714-5752736 CTGCAATGAGCATTTTTCAGCGG - Intergenic
1146100147 17:29973032-29973054 CTGCAGTGGCCCCTGTCTAGGGG - Intronic
1146257805 17:31401670-31401692 CTGCAGTGGGCACTGTCCCCAGG + Intronic
1146521248 17:33527200-33527222 CAGTAGGGTGCACTGTCCAGTGG + Intronic
1147163268 17:38579802-38579824 CTTCAGTGACCAGTGGCCAGGGG + Intronic
1149728147 17:58918138-58918160 CTGCTGTGAGCACAGTCAAATGG - Intronic
1149853262 17:60054428-60054450 CTCCACTGAGCACTGCCTAGTGG + Intronic
1150000290 17:61432100-61432122 CTGCAGTGAGTACTAGCCACTGG + Intergenic
1150543015 17:66123054-66123076 CTACACTGGGCACTGTGCAGAGG + Intronic
1151415598 17:73960673-73960695 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
1151703273 17:75754284-75754306 CTGCAGTCAGCTCTGCCCTGGGG - Intronic
1151766850 17:76137311-76137333 CTGACTTGGGCACTGTCCAGAGG + Exonic
1151798987 17:76366384-76366406 CTGAAGTGAGGGCTGTCCTGTGG + Intronic
1152218506 17:79048253-79048275 CTGCCGTCAGCTCTCTCCAGAGG - Exonic
1152802761 17:82339584-82339606 CTGCACGGAGCACCGTCCTGGGG - Intergenic
1153556876 18:6324001-6324023 ATGCAGGGAGCAGTGTCCTGAGG - Intronic
1153922594 18:9804742-9804764 CTGCAGTGAGCACGGACCTGTGG + Intronic
1155879125 18:31122287-31122309 CTGCAGAGGGCACTGTCTAAGGG + Intergenic
1158548864 18:58417900-58417922 CTACAGAGAGCCCTGACCAGAGG - Intergenic
1158660128 18:59379544-59379566 CTGCAGTGGGAAGTGACCAGAGG + Intergenic
1158904802 18:62001465-62001487 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
1160501575 18:79403685-79403707 CAGCAGTGGGCACAGGCCAGTGG - Intronic
1160901903 19:1432985-1433007 CAGCTGTGATCACTGTCTAGAGG + Intronic
1161836291 19:6649329-6649351 GTGCAGTGAGCAGTGGCCAGAGG - Intergenic
1164314298 19:24073199-24073221 CTCCAGTGGGCACTGTCCATGGG - Intronic
1164623073 19:29708899-29708921 CTGCAGTGGGCCCTGAGCAGAGG + Intronic
1164743646 19:30595037-30595059 CTGCAGTGGGCACCGCACAGAGG + Intronic
1166499476 19:43330189-43330211 ATGCAGTGAGCAGTGTCCTGAGG + Intergenic
1166735557 19:45082121-45082143 CTTCACTCAGAACTGTCCAGTGG + Intronic
1166750929 19:45163718-45163740 CTGCAGAGAGAACTGTCTGGCGG - Intronic
1168107957 19:54175608-54175630 CTGCAGTGAGCCTTGTCGTGTGG - Intronic
925018813 2:552812-552834 CTGCTGTGATCACAGCCCAGGGG - Intergenic
925357126 2:3249791-3249813 ATGCAGGGAGCAGTGTCCTGAGG - Intronic
925393101 2:3512449-3512471 ATGCAGGGAGCAGTGTCCTGAGG - Intronic
925782895 2:7399281-7399303 CTGCAGTGACCCATGTCCAGGGG + Intergenic
926126927 2:10277691-10277713 CTGAAGTGAGCCATGGCCAGTGG + Intergenic
927931948 2:27051152-27051174 CTGCACTGTTCACTGACCAGTGG - Intronic
928235060 2:29532027-29532049 CAGCAGTGAGCACTGCACACTGG - Exonic
928446353 2:31336899-31336921 CTGAAGTGGGCTCTGTACAGTGG - Intronic
928732459 2:34247387-34247409 CTGCAGTGCGCTCTCTCCAGCGG + Intergenic
929932606 2:46270665-46270687 CTGCAGAGGGACCTGTCCAGTGG - Intergenic
930234040 2:48872049-48872071 CTGCAGTGAGCAATAACCTGTGG + Intergenic
930616556 2:53600180-53600202 CTGCAGTGAGCTGTGACCACTGG - Intronic
931533596 2:63246310-63246332 CTGCAGTGAGCACAAACCACTGG - Intronic
932196151 2:69785815-69785837 CAGGATCGAGCACTGTCCAGAGG - Intronic
932845974 2:75136193-75136215 CTGGAGTGAGGGCTGTACAGAGG - Intronic
933439826 2:82297969-82297991 ATGTAGGGAGCAGTGTCCAGAGG + Intergenic
934179608 2:89608941-89608963 CTGCAGTGTGCACAGTCAAGGGG - Intergenic
934289899 2:91683199-91683221 CTGCAGTGTGCACAGTCAAGGGG - Intergenic
934560064 2:95308559-95308581 CTGCAGTGTGCAGAGACCAGTGG + Intronic
934936940 2:98472423-98472445 CTGGGGAGAGCACAGTCCAGTGG + Intronic
936011912 2:108930379-108930401 CAGCAGTGAGCACTCACAAGCGG - Intronic
936586786 2:113764937-113764959 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
936874447 2:117171922-117171944 ATGAAGGGAGCAGTGTCCAGAGG - Intergenic
937137234 2:119564082-119564104 CTGCAGGCAGCACTGAGCAGGGG + Intronic
937321636 2:120964425-120964447 TTGCAGTGAGCACTGTGGATTGG + Intronic
937377947 2:121350568-121350590 CTGAAGTGAGCCCTGTTCATGGG - Intronic
937465320 2:122127294-122127316 ATGCAGTGAGCAGTGTCCAGAGG - Intergenic
938124539 2:128662490-128662512 CTGCAGTCTGCTCTGTCCTGAGG - Intergenic
938258883 2:129881240-129881262 CTACAGTGTTCACTGTGCAGAGG + Intergenic
939064075 2:137461514-137461536 GTGCAGTGAGCAGAGTCCAGTGG - Intronic
940149064 2:150578895-150578917 ATGCAGAGAGCAGTGTCCTGAGG + Intergenic
941181222 2:162261710-162261732 CTGCAGCCAGCAGTGTTCAGTGG - Intergenic
943602979 2:189943239-189943261 ATGCAGGGAGCACTGTCCTGAGG - Intronic
944491510 2:200262733-200262755 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
944731137 2:202518467-202518489 CTGAAATCAGCACTGTGCAGTGG - Intronic
948155662 2:235778890-235778912 CTGCAGTGAGGACTGCCACGGGG - Intronic
948277338 2:236719245-236719267 CTGCTGTCAGAACTGTCCCGCGG + Intergenic
948392889 2:237625557-237625579 CTGCCGTGGGGACTGGCCAGAGG - Intergenic
948462652 2:238137853-238137875 CTGGTGTGAGAAATGTCCAGTGG + Intergenic
1168820839 20:772868-772890 CTGCAGAAAGCACGGTCCAGGGG + Intergenic
1169776712 20:9263174-9263196 GTCCAGTCAGCACTGGCCAGGGG + Intronic
1170415390 20:16133691-16133713 TTGCATTGGGCACTGTCCAGGGG + Intergenic
1170774977 20:19367262-19367284 CTCCTGTGACCACTATCCAGAGG - Intronic
1170941690 20:20853527-20853549 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
1172212899 20:33213521-33213543 CTGCAGGAAGAGCTGTCCAGTGG - Intergenic
1173289535 20:41702209-41702231 CTGCAGTGAGAAGTTTGCAGAGG + Intergenic
1174847077 20:53952832-53952854 GTTCAGAGAGCACTGCCCAGTGG - Intronic
1175603010 20:60290050-60290072 ATGCAGGGAGCACTGTCCTGAGG + Intergenic
1175772722 20:61633766-61633788 CTGGACTGAGCTCTGTGCAGGGG - Intronic
1175808969 20:61847262-61847284 ATGAAGGGGGCACTGTCCAGTGG - Intronic
1176022036 20:62966902-62966924 CTGCCGTCAGCAAAGTCCAGTGG - Intronic
1177206444 21:18016533-18016555 CTGCAGGTAGCAGTGTCCTGAGG - Intronic
1178691746 21:34755504-34755526 CTGCAGGGAGCACTGGGCTGGGG + Intergenic
1178862850 21:36303867-36303889 CAGGTGTGAGCACTGGCCAGAGG + Intergenic
1179433115 21:41338766-41338788 CTGAAGTGAGCACAGCCCTGTGG + Intronic
1179894466 21:44353640-44353662 CTGGAGAGAGGACTGTCCTGAGG + Exonic
1180011331 21:45053540-45053562 CTGCACTGAAAACTGGCCAGCGG + Intergenic
1180972288 22:19821902-19821924 CTGGAGTGAGCCCTGGACAGAGG - Intronic
1185020893 22:48374372-48374394 ATGCAGTGAGCACTGGGCAATGG - Intergenic
1185032580 22:48452287-48452309 CAGCAGTGAGCACTGCCCCCCGG + Intergenic
950060109 3:10063821-10063843 CTGCAGTGAGCAGTCTCCTCAGG + Exonic
950301474 3:11883044-11883066 CTGCAGTGAGCAGTCTCCTCAGG + Intergenic
950955964 3:17053755-17053777 CTACAGGGAGCAGTGTCCAGGGG + Intronic
955971302 3:64441231-64441253 CTGCAGGGAGCACCCTGCAGTGG + Intronic
956161145 3:66353848-66353870 CTCCAGTAAGCACCGTCCTGTGG - Intronic
963066101 3:141265860-141265882 CTGCTCTGAGCACTTTCCCGTGG - Intronic
963348663 3:144126425-144126447 CTGAAGGGAGCACAGCCCAGTGG - Intergenic
967154653 3:186681395-186681417 CATAAGGGAGCACTGTCCAGGGG - Intergenic
967156257 3:186695234-186695256 CATGAGGGAGCACTGTCCAGGGG - Intergenic
967158077 3:186711651-186711673 CATGAGGGAGCACTGTCCAGGGG - Intergenic
967827801 3:193892588-193892610 CTGCAGTGAGAGCTGGTCAGAGG + Intergenic
967861156 3:194153000-194153022 CTGCAGTGAGCTGAGCCCAGAGG - Intergenic
968489011 4:880213-880235 ATGCAGGGTGCACGGTCCAGTGG - Intronic
968489032 4:880325-880347 ATGCAGAGTGCACGGTCCAGTGG - Intronic
969056843 4:4407602-4407624 CTGCAGGGAGCCCTGGCCACAGG - Intronic
969090993 4:4693925-4693947 CTGCAGTGAGCTCTGGGCCGTGG + Intergenic
969829673 4:9784676-9784698 CTGCAGTGTGCACAGCCAAGGGG + Intronic
970465469 4:16318190-16318212 CTGCAGTGAGTACTCGGCAGGGG + Intergenic
971391627 4:26191571-26191593 GTGCAGGGAGCAAAGTCCAGAGG + Intronic
971545487 4:27880195-27880217 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
971969627 4:33604787-33604809 ATGCAGGGAGCTGTGTCCAGTGG + Intergenic
972202909 4:36736953-36736975 CTACAGTGAGCACTTTCTAAAGG - Intergenic
972367771 4:38392463-38392485 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
972829920 4:42802888-42802910 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
972976612 4:44643685-44643707 ATGCAGGGAGCAATGTCCTGAGG - Intronic
973367576 4:49220031-49220053 ATGCAGTCAGCAGTGTCCTGAGG + Intergenic
974352114 4:60762206-60762228 CTTCAGTGAGCAGAGTCCAATGG - Intergenic
974973311 4:68858532-68858554 ATGCAGGGAGCAATGTCCTGAGG - Intergenic
976114502 4:81712548-81712570 CAGCACTGAGCACTGAGCAGAGG + Intronic
976734926 4:88299691-88299713 CTGCATTGAGGACTGTCCAGTGG + Intergenic
978206893 4:106090304-106090326 ATGCAGGGAGCACTGTCCTGAGG + Intronic
978408673 4:108405869-108405891 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
981603402 4:146517596-146517618 CTCCAGAGAGCATTTTCCAGAGG + Intronic
981808627 4:148747119-148747141 CTTCTGTGAGCACTATCCAAGGG + Intergenic
981920410 4:150079169-150079191 CTGCAGTGGGCACTGTGCGCCGG - Exonic
982057274 4:151564597-151564619 TTTCAGTGGACACTGTCCAGTGG - Intronic
984651396 4:182274460-182274482 CTTCAGTGATGACTGTTCAGAGG + Intronic
984941025 4:184932534-184932556 CTGCAGTCAGCAGACTCCAGGGG - Intergenic
986281873 5:6330168-6330190 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
986299731 5:6468361-6468383 CTGCTGTGTGCACTGGCCTGAGG + Intronic
987304775 5:16627129-16627151 CTGCAGAGAACTCTGTTCAGAGG + Intergenic
989382566 5:40823579-40823601 CTGCCATGTGCACTGACCAGAGG + Intergenic
990006031 5:50945343-50945365 ATGCAGAGAGCAGTGTCCTGAGG - Intergenic
990557615 5:56951798-56951820 CTGCAGTGAGCCCTGCCCCAGGG - Intronic
991007658 5:61845847-61845869 ATGCAGGGAGCAGTGTCCAGAGG - Intergenic
991259263 5:64649753-64649775 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
992739911 5:79763174-79763196 CTGCAGACAGCACTCTCCTGAGG + Exonic
993344721 5:86768939-86768961 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
997110220 5:131066538-131066560 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
998527473 5:142856097-142856119 CTGAAGTGAGCACTGGGCTGTGG + Intronic
999203487 5:149832735-149832757 CTGCAGGCAGCACTGTGCCGAGG - Exonic
1000388177 5:160695365-160695387 GTGCAGTGAGCACATTACAGAGG + Intronic
1001944454 5:175767100-175767122 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
1002002981 5:176208564-176208586 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
1002223531 5:177702691-177702713 ATGCAGGGAGCAGTGTCCCGAGG - Intergenic
1003240281 6:4339218-4339240 CTGCAGTGAGCACAAGCCACTGG + Intergenic
1003482932 6:6549573-6549595 CTGCAGTGGGCACAGTCCTTCGG + Intergenic
1003968985 6:11280426-11280448 CAGCAGTCAGAACTGGCCAGGGG + Intronic
1004756735 6:18618363-18618385 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
1009192473 6:60645993-60646015 ATGCAGTGAGACCTGTCAAGTGG - Intergenic
1013103374 6:107006166-107006188 TTGCAGTGAGCAGAGTGCAGTGG - Intergenic
1014018435 6:116561866-116561888 CTGCAGAGTGCAGGGTCCAGGGG - Intergenic
1015331710 6:131987635-131987657 CTGCAGTGAGCTGAGTACAGTGG - Intergenic
1016028074 6:139309131-139309153 GGGCAGTGATGACTGTCCAGTGG + Intergenic
1017095475 6:150800882-150800904 CTGGCATGAGCACTTTCCAGGGG + Intronic
1017647792 6:156555121-156555143 CTGCAGAGACTACTGTCCACTGG + Intergenic
1017714218 6:157196855-157196877 CTGCAGTGAGGCCTGTGCTGTGG - Intronic
1018296724 6:162354725-162354747 CTGAGGATAGCACTGTCCAGAGG - Intronic
1019928555 7:4208748-4208770 GTGTAGTGAGCAGTCTCCAGGGG - Intronic
1024562285 7:50654515-50654537 CTGCAGTGAGCTCTTTCTAGAGG - Intronic
1024655943 7:51451491-51451513 CCCCAGTGAGCACTGTCCTCTGG - Intergenic
1024824686 7:53378030-53378052 CTGCAGTGAGTTCTGACCAATGG - Intergenic
1030505609 7:110418120-110418142 CTGCAGTGAGCAAAGTGGAGGGG - Intergenic
1033784807 7:144717781-144717803 ATGCAGGGAGCAGTGTCCTGAGG - Intronic
1034399088 7:150849580-150849602 GTGCAGTGACCACTCTCCTGGGG + Intronic
1034447067 7:151119189-151119211 CTGCAGTGGTCCCTGTCCCGAGG + Intronic
1035128580 7:156629844-156629866 ATGCAAGGAGCAGTGTCCAGAGG - Intergenic
1035391426 7:158507240-158507262 GGTCAGTGAGGACTGTCCAGGGG + Intronic
1041697937 8:60757146-60757168 TTCCAGAGAGCTCTGTCCAGTGG + Intronic
1042863372 8:73335395-73335417 CTGCAGTGTGCACTGTGGTGGGG - Intergenic
1044125537 8:88454347-88454369 CTGCAGTGAGCACAAGCCACTGG - Intergenic
1045294329 8:100860558-100860580 CTGCACTGAGCACAGTCTGGTGG + Intergenic
1045331353 8:101158352-101158374 CTGCAGTGAGGACTTTACACAGG + Intergenic
1046453488 8:114425379-114425401 CACCAGTGAGCACTGTGCTGTGG + Intergenic
1046888928 8:119400380-119400402 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
1048127847 8:131656931-131656953 CTGCAGTTAGCACTGTTCTGTGG - Intergenic
1049255409 8:141611148-141611170 CCGCAGTGAGCACCAACCAGTGG + Intergenic
1049630401 8:143651653-143651675 CAGCTGTGAGCACTGTCCTCAGG + Exonic
1049770414 8:144377898-144377920 CTGCTGAGACCACTGACCAGTGG - Intronic
1050935166 9:11386927-11386949 ATGCAGTAAGCAGTGTCCCGAGG - Intergenic
1052977118 9:34419444-34419466 CTTTAGGGAGCACAGTCCAGAGG + Intronic
1055224844 9:73983964-73983986 CTGCTGGGAGCTCTGTCTAGTGG - Intergenic
1056739889 9:89245474-89245496 CTGCAGTGATCGCTGGCTAGAGG + Intergenic
1057173403 9:92977032-92977054 CAGCAGTGAGCACTGTGCAAAGG - Intronic
1057325740 9:94061733-94061755 GTGCAGGGAGCAGTGTCCTGGGG + Intronic
1057332481 9:94128826-94128848 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
1057444409 9:95103764-95103786 CTGCAGTGAGCTCTGCGCAGTGG - Intronic
1059342475 9:113605660-113605682 CTGCAGTGAGAACTTTCCCCAGG - Intergenic
1059617588 9:115967635-115967657 ATGCAGGGAGCAGTGTCCAGAGG + Intergenic
1060453587 9:123767108-123767130 TTGCAGTTAGCACTGTCAAATGG - Intronic
1062040326 9:134401594-134401616 CTGCACTGACCACTCTCCTGCGG + Intronic
1188944123 X:36277043-36277065 CTGCAGTGAGAACCTTCCTGTGG + Intronic
1189011789 X:37053324-37053346 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
1189036920 X:37502962-37502984 ATGCAGGGAGCAGTGTCCTGAGG + Intronic
1193406411 X:81107272-81107294 ATGCAGAGAGCAGTGTCCTGAGG - Intergenic
1193492020 X:82162113-82162135 ATGCAGGGAGCAGTGTCCCGAGG - Intergenic
1195035073 X:100965074-100965096 ATGCAGGGAGCAGTGTCCCGAGG - Intergenic
1195160107 X:102162561-102162583 ATGCAGGGAGCAGTGTCCTGAGG + Intergenic
1196547169 X:116975748-116975770 ATGCAGGGAGCAGTGTCCTGAGG - Intergenic
1196970244 X:121100184-121100206 ATGCAGTGAGGAGTGTCCAGAGG + Intergenic
1198077071 X:133204064-133204086 CTCCAGTGAGCACTGCTCAAAGG + Intergenic
1201628054 Y:16036885-16036907 CTGCTGTAAATACTGTCCAGTGG - Intergenic
1202241017 Y:22770183-22770205 CTGCAGTGAGCAGTGCACATTGG - Intergenic
1202394003 Y:24403926-24403948 CTGCAGTGAGCAGTGCACATTGG - Intergenic
1202476782 Y:25266166-25266188 CTGCAGTGAGCAGTGCACATTGG + Intergenic