ID: 1131075995

View in Genome Browser
Species Human (GRCh38)
Location 15:89495328-89495350
Sequence GAGAATGTCTAAGGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131075986_1131075995 30 Left 1131075986 15:89495275-89495297 CCATTCTGAAAGTGTGCAGTTGT 0: 1
1: 0
2: 0
3: 11
4: 187
Right 1131075995 15:89495328-89495350 GAGAATGTCTAAGGTGTGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131075995 Original CRISPR GAGAATGTCTAAGGTGTGGA GGG Intronic
902812896 1:18899171-18899193 GAGAATGTCTAAGGAATGGTGGG + Intronic
904009367 1:27381070-27381092 CAGAAGGTGTAAGGGGTGGAAGG + Intronic
905282715 1:36859461-36859483 GAGAAGGTCTAAGCTGCAGAGGG - Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906125315 1:43423763-43423785 GAGTAGGTCAGAGGTGTGGAAGG + Intronic
906125331 1:43423847-43423869 GAGTAGGTCAGAGGTGTGGAAGG + Intronic
906569405 1:46823240-46823262 GTGAGTGTCTAAAGTGTGAAAGG - Intergenic
909340667 1:74527870-74527892 GAGAATGTCTATGTGGTGGATGG + Intronic
910462166 1:87459249-87459271 GAGAAGGCCAAAGGTGTGGCTGG + Intergenic
911285153 1:95982599-95982621 GAGAATGTGTAACTGGTGGAGGG + Intergenic
913381932 1:118221007-118221029 TAGAATGTATAATCTGTGGAAGG + Intergenic
914427625 1:147592653-147592675 GAGAATGAGTAAGGTATTGAGGG + Intronic
915775460 1:158480149-158480171 TAGAATGACAAAGGTGTAGAAGG - Exonic
916606696 1:166349986-166350008 GAAAATAACTAAGGTGTGGAAGG + Intergenic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
918556153 1:185801772-185801794 GAGAAACTAAAAGGTGTGGAGGG + Intronic
919570601 1:199243177-199243199 GAGAAGGTCAAAGGTGGGGAGGG + Intergenic
919859692 1:201731377-201731399 GAGAGTGTCTGAGAGGTGGAGGG + Intronic
921083873 1:211768974-211768996 GGGAATGACTAAGGAGTAGAAGG + Intronic
922443503 1:225677120-225677142 CAGAACGTCTAAGGTGTGCGGGG - Intergenic
922765301 1:228153234-228153256 GAAAAGGGCCAAGGTGTGGATGG + Intronic
923021217 1:230165662-230165684 GAGAATGTCCCAGCTGTTGAAGG + Intronic
1064177117 10:13084813-13084835 GAGATTGTCTAGGGAGAGGAAGG + Intronic
1064496109 10:15912036-15912058 GAGAATGGCTGAGAAGTGGAGGG - Intergenic
1069020847 10:63486826-63486848 GGGAATGCCACAGGTGTGGAAGG - Intergenic
1070070327 10:73082174-73082196 GAGCATGTTTAAGGTGTGCTAGG + Intronic
1070421620 10:76243079-76243101 GGGAAGTTCTGAGGTGTGGATGG - Intronic
1072742910 10:97920982-97921004 GAGAATGAGTGAGGGGTGGAAGG + Intronic
1074212382 10:111348207-111348229 GAGAATGTTGAGGGTGTGGAAGG + Intergenic
1075992621 10:126850545-126850567 GAGGATGACCAAGGTGTCGAGGG - Intergenic
1077786148 11:5385521-5385543 GACAGTGTCTAAGATGTGGTAGG - Intronic
1078534486 11:12162238-12162260 GAGAATGTTGAAGGCCTGGAGGG - Exonic
1078666757 11:13332122-13332144 GAGAAGGTCAGAGGTGGGGAGGG + Intronic
1080848780 11:36049630-36049652 GGGAATGTCTTAGGTCTGAAAGG + Intronic
1082703231 11:56459909-56459931 GAGCATGGGTAAGGTGGGGATGG + Intergenic
1083378309 11:62244010-62244032 GAGAGTGTCGTGGGTGTGGAGGG - Intronic
1085643578 11:78208589-78208611 GAGAATGTTTGAGGTGTGCCAGG + Intronic
1088319274 11:108538465-108538487 CAGAATGTATAAGGTGAGGGAGG - Intronic
1095726231 12:45455966-45455988 GACACTGCCTAAGGGGTGGAGGG + Intergenic
1097670228 12:62527743-62527765 GAGAATGACCAAGGTGAAGATGG + Intronic
1101327949 12:103733037-103733059 GAGAGTGACTGGGGTGTGGATGG - Exonic
1103982781 12:124747269-124747291 GTGATTGCCCAAGGTGTGGAGGG - Intergenic
1105436517 13:20383498-20383520 GAGGATGTGTAAGGGGTGGACGG + Intergenic
1106900337 13:34349017-34349039 GAAAATGTATAAGGTGTAGCAGG - Intergenic
1107028482 13:35826994-35827016 GAAAATGTCAAATGTATGGAAGG + Intronic
1107629168 13:42325947-42325969 GAGAATGTCAAATCTGTGGCTGG - Intergenic
1108935848 13:55879110-55879132 GAGAATGTTGCAGGTTTGGAGGG - Intergenic
1109473356 13:62842197-62842219 GAGAATGTGTAAGAAGTGGTTGG + Intergenic
1109727834 13:66367934-66367956 GAAAATGTCTAAGGATTGCATGG - Intronic
1109765220 13:66886519-66886541 GAGAATCACTCAGCTGTGGATGG - Intronic
1110398901 13:75066842-75066864 CATAATGTATGAGGTGTGGAGGG - Intergenic
1111586248 13:90288006-90288028 GAGAATGTTGCAGGTTTGGAAGG + Intergenic
1114568482 14:23649319-23649341 GAGGATGTGGGAGGTGTGGAGGG + Intergenic
1118695732 14:68383322-68383344 GACAATGTCACAGATGTGGAGGG + Intronic
1119201976 14:72760536-72760558 GTGGATGTCTGAGGTGAGGAGGG + Intronic
1119245515 14:73102938-73102960 GAGATTGTGTCAGGTGTGGCTGG - Intronic
1119722519 14:76900826-76900848 GTGCAAGTCTAAGATGTGGAGGG - Intergenic
1119970668 14:78966506-78966528 GAGAATGTGTCAGGAATGGAGGG - Intronic
1121623179 14:95364408-95364430 GAGAATGCCTGGGGTGTGGGGGG + Intergenic
1121679005 14:95777134-95777156 GAGAATGAGTAAGATGGGGAAGG + Intergenic
1122310729 14:100792458-100792480 GAGAATGACAGAGATGTGGAGGG - Intergenic
1124791178 15:32728865-32728887 GAGAATTATTAAAGTGTGGAGGG - Intronic
1124944619 15:34252608-34252630 TAGAATTTCTATGTTGTGGATGG + Intronic
1126878866 15:53072994-53073016 GAAAATGTATAAGATGCGGAAGG + Intergenic
1127538970 15:59918345-59918367 GAGAATGTATGAGATGAGGAAGG - Intergenic
1129367350 15:75064489-75064511 GAGAATGTGGCAGGTTTGGAGGG + Intronic
1131075995 15:89495328-89495350 GAGAATGTCTAAGGTGTGGAGGG + Intronic
1131381389 15:91966728-91966750 TAGAATGTCTCAGCAGTGGAAGG + Intronic
1131789752 15:95951263-95951285 GAGAATAACTGAGGTGTTGAGGG - Intergenic
1132436620 15:101810369-101810391 GACAATGTCGAAGGTGTCCACGG + Intronic
1133417606 16:5618707-5618729 GAGAATTTCAAAGGGATGGATGG - Intergenic
1134202888 16:12213598-12213620 GAGAGTGTCCAGGCTGTGGAAGG + Intronic
1136929084 16:34402978-34403000 GAGAATTTCTGGAGTGTGGAAGG - Intergenic
1136975490 16:35008826-35008848 GAGAATTTCTGGAGTGTGGAAGG + Intergenic
1139080025 16:63506171-63506193 GAGAATGTGTCAGCTGTCGAGGG - Intergenic
1139251584 16:65501596-65501618 GAGTTTGTCTAAGATGTAGAGGG - Intergenic
1139480913 16:67230203-67230225 GAGAAGTTCTCAGGTGTGGCTGG - Exonic
1139698425 16:68692029-68692051 AAAAATGTTTAAGGAGTGGACGG - Intronic
1141645596 16:85365786-85365808 GGGAATGACTAGGCTGTGGATGG + Intergenic
1143670767 17:8394177-8394199 GAGAATGACTGAGCTGTGGCAGG - Exonic
1145911645 17:28546786-28546808 GACACTGCCTAAGGTGTGGGAGG - Exonic
1146707536 17:35012194-35012216 GAGAATGTCTTAAGTGTATAGGG + Intronic
1147918793 17:43904052-43904074 GAGAATGGCTTGGGGGTGGAGGG - Intronic
1148293687 17:46479907-46479929 AAGAATGCCAAAGGTTTGGATGG + Intergenic
1148315872 17:46697610-46697632 AAGAATGCCAAAGGTTTGGATGG + Intronic
1150884395 17:69068819-69068841 GATAATGACTAATGTGTGCAGGG + Intergenic
1152968749 18:141225-141247 GGGGATGTCAATGGTGTGGATGG + Intergenic
1153621397 18:6981611-6981633 GAAAATGTATAATGTGTTGATGG - Intronic
1155764368 18:29608989-29609011 GAAATTGTCTAAGGTGGGCATGG + Intergenic
1157515106 18:48305264-48305286 CAGAAGGTCTCAGGTATGGATGG - Intronic
1163537878 19:17888134-17888156 GAGGACGTCTAGGGTGGGGATGG + Intronic
1165983394 19:39746115-39746137 GAGATTGGCAAAGCTGTGGATGG - Intergenic
1166162066 19:40961556-40961578 TAGAATGACTAACGGGTGGATGG - Intergenic
1166784452 19:45359291-45359313 GAGAATGACAAAGGTAGGGATGG + Intronic
1167403866 19:49291046-49291068 GAGAATGTCTATGATGTGCCAGG + Intronic
927696725 2:25244428-25244450 GAGCATGGCTAGGGGGTGGAGGG + Intronic
931828503 2:66026245-66026267 GGGAAAGTGTAGGGTGTGGAGGG + Intergenic
931878556 2:66541462-66541484 GAAAATGACATAGGTGTGGAAGG - Intronic
933332680 2:80914316-80914338 GAGTATGTAGAAGGTGAGGATGG - Intergenic
933596755 2:84290339-84290361 GAGACTGTCGACGGTGTGAAGGG + Intergenic
933911729 2:86946553-86946575 CAGAATGTCTAAAGTGGGGCCGG - Intronic
934011267 2:87823342-87823364 CAGAATGTCTAAAGTGGGGCCGG + Intronic
935373845 2:102375406-102375428 GAGGGTGTCAAAGGTGTGGGTGG + Intronic
935832028 2:107010460-107010482 AAGAGAGTCTGAGGTGTGGAGGG + Intergenic
937845479 2:126574325-126574347 ATCAATGTCTGAGGTGTGGATGG - Intergenic
937882271 2:126877327-126877349 GAGAATGTTCATGGTGAGGATGG - Intergenic
939241008 2:139559795-139559817 GAGAATGTGTAATGTGTTTAGGG + Intergenic
945535661 2:211014771-211014793 GAGAATATCTGAGTTTTGGAAGG - Intergenic
945972821 2:216246867-216246889 GAGAATGTCATAGGCATGGAAGG - Intergenic
1169861164 20:10153992-10154014 GAGAATGACTGAGGTGGGGGAGG - Intergenic
1170910616 20:20563599-20563621 TATAATGTCCAAGGTGAGGAAGG + Intronic
1171519055 20:25761759-25761781 GAGAATGTTGAAGGTGAGCATGG + Intergenic
1175238056 20:57526522-57526544 GGGAATGGATAAGGAGTGGAGGG + Intergenic
1176522306 21:7833688-7833710 GAGAAAGTCTAAGGGGTCCAGGG + Intergenic
1177335364 21:19718137-19718159 GAGAATATAGAAAGTGTGGATGG + Intergenic
1177834572 21:26173940-26173962 GAGAATGGCCAAGGTGTGGAAGG - Intergenic
1178656326 21:34463700-34463722 GAGAAAGTCTAAGGGGTCCAGGG + Intergenic
1179391248 21:40993997-40994019 GAGTATGTCTGATGTGTGTAGGG - Intergenic
1179779947 21:43693117-43693139 GACGCTGTCTAAGGTGTTGAAGG + Intronic
1180741824 22:18058824-18058846 GAGAATGTCTACTCTGTGGTAGG + Intergenic
1183430239 22:37761606-37761628 GTGAATGTCAAGGGTCTGGAGGG + Intronic
1184991684 22:48174573-48174595 CAGATCGTCCAAGGTGTGGATGG + Intergenic
949985547 3:9537863-9537885 GAGAAGGTCTCAGCTGTGGATGG - Intronic
951573313 3:24088257-24088279 GAGCATTTGTAAGTTGTGGAAGG + Intergenic
954349158 3:50028191-50028213 GAGAATCTGTAAGGAATGGAAGG - Intronic
954868286 3:53748120-53748142 AAGAATGGCTAAGATGTTGATGG + Intronic
960811722 3:121632784-121632806 GAGAATGTAAAAGGTGTGAGGGG + Intronic
962775738 3:138657932-138657954 GAGAAGGGCTCAGATGTGGATGG - Intronic
967631038 3:191743146-191743168 GAGAATGTTGCAGGTTTGGAGGG - Intergenic
969086718 4:4662122-4662144 GAGACTGTCTGAGGAGAGGATGG + Intergenic
971073360 4:23120431-23120453 GAGAATGTTTTAGGGGTGGAGGG + Intergenic
971090705 4:23342077-23342099 GAGAATGTTGACGGTGTGGAAGG + Intergenic
972195746 4:36651695-36651717 GAAGATGTCTAAGGTAGGGAAGG + Intergenic
973016885 4:45151107-45151129 GACAATTTCTAAGGTTTGAAGGG - Intergenic
974916763 4:68187367-68187389 GAGAATGTGTGAGCTGTGGAAGG + Intergenic
979500043 4:121429357-121429379 CAGAATGCCTAAACTGTGGAGGG + Intergenic
979815731 4:125101348-125101370 GAGAAAGCCAAAGGTGTGGCTGG + Intergenic
979936448 4:126703229-126703251 CACAAAGTCAAAGGTGTGGAAGG - Intergenic
981424127 4:144584073-144584095 GATACTGTCTAAATTGTGGAGGG + Intergenic
983477227 4:168229186-168229208 GTGAATGTCCAAAGTGTGAAAGG + Intronic
984846600 4:184113511-184113533 GAAAATGAATAAGGTGTGAAAGG - Intronic
986913070 5:12581507-12581529 GAGAATGTAAAATGTGTAGATGG + Intergenic
988623662 5:32848557-32848579 AAGAATGTCTGGTGTGTGGAAGG - Intergenic
989387791 5:40870407-40870429 GAGAAGGGCTGAGGTGTGAATGG - Intergenic
990783476 5:59393542-59393564 GAGATTATCTCAGGTGTGAATGG - Intronic
994861975 5:105208649-105208671 GAGAATGTGTAAGATGTGTTTGG - Intergenic
995786043 5:115829263-115829285 GAGAAAGCCTTAGGTGTTGAAGG - Exonic
996653906 5:125915561-125915583 GAGAATGTTTCAGGTTTGGAGGG + Intergenic
997049545 5:130363217-130363239 GAGAATATCCAGGGTGTGGTTGG - Intergenic
997935869 5:138110474-138110496 GAGAAAGAATAAGGTGTGGGGGG + Intergenic
1003084822 6:3052922-3052944 GAGCAGGTCTAAGGTGAGGCAGG + Intergenic
1003155061 6:3586365-3586387 GAGAATGTCAAAGGTGAGACTGG - Intergenic
1005801695 6:29432031-29432053 GAAAATGGCTCAGGAGTGGAGGG - Intronic
1007246552 6:40467453-40467475 GAGCATGGCTGAGCTGTGGAGGG - Intronic
1007841700 6:44721530-44721552 AAGAATGTCTACGGTGTGCAGGG + Intergenic
1008169117 6:48180671-48180693 GGGTATGCCTAAAGTGTGGAAGG + Intergenic
1011245361 6:85316384-85316406 TAGAATGGCTGAGGTGTGCAAGG - Intergenic
1012448114 6:99327547-99327569 GGGAATATGTAAGGGGTGGAAGG - Intronic
1014615600 6:123594845-123594867 GAGAAATTCTAAGTTGTGAAAGG + Intronic
1016367727 6:143337411-143337433 GAGAATGCCAAGGGTGTGGCTGG - Intronic
1021073881 7:16276170-16276192 GAGAATGTAATAGCTGTGGATGG + Intronic
1021781801 7:24113931-24113953 GAGACTGGCTAAAATGTGGATGG + Intergenic
1023299248 7:38751570-38751592 GTAAATGTCTAATGTGTGGTGGG + Intronic
1024182192 7:46907839-46907861 CAGGATGTCTAAGGTGGGTAAGG - Intergenic
1029036003 7:97522586-97522608 GAGAATCTCTAAGGTTTAAAAGG - Intergenic
1031659275 7:124400011-124400033 TAGAATCTCCAAGGTATGGAGGG + Intergenic
1033131865 7:138751667-138751689 GGGAATGTCTAAGGAATGAATGG + Intronic
1037829710 8:22180247-22180269 GAGAATGCCTGAGGAGTGGGAGG - Intronic
1040935943 8:52782392-52782414 GAGAAGGTCTAAGCAGTAGATGG + Intergenic
1041004384 8:53484699-53484721 GAAAATGCCTAAGGTGTGGGGGG + Intergenic
1041175023 8:55187095-55187117 GAGAATGTCAAGGCTGTGAAAGG - Intronic
1044950111 8:97427673-97427695 TAGAATGTCTGAGGTGGGGGAGG - Intergenic
1046977028 8:120290992-120291014 GAGAATGTGAAAGCTATGGAAGG + Intronic
1048413156 8:134196994-134197016 CAGAATGTGTAAGGGGAGGATGG - Intergenic
1048726776 8:137394996-137395018 GAAAATGTCTATGGATTGGAAGG - Intergenic
1049514847 8:143048807-143048829 GAAAATGCATAAGGTCTGGAGGG - Intronic
1050593081 9:7180045-7180067 AAGAATCTCTAGGGAGTGGAAGG + Intergenic
1050692739 9:8246609-8246631 TAGAATGTCTAAGCCATGGAGGG - Intergenic
1051444337 9:17124611-17124633 CAGAAAGTCTACGGTGTGAATGG + Intergenic
1051444523 9:17126272-17126294 CAGAAAGTCTAGGGTGTGGATGG - Intergenic
1051927199 9:22343131-22343153 GAGAAGGCCTAAAGTATGGAGGG - Intergenic
1052798582 9:32946640-32946662 GAGAATGTCAGGGGTGTTGAGGG - Intergenic
1053230303 9:36401978-36402000 GAGAATGTCCAAGGTCCAGAAGG - Intronic
1186335599 X:8583477-8583499 GAGAATGAGAAAAGTGTGGAAGG + Intronic
1188102675 X:26109277-26109299 GGGAAGGTTTAAGATGTGGAGGG + Intergenic
1188376021 X:29428968-29428990 GTGAATGTATATGGTGTGGTTGG - Intronic
1190582156 X:51899801-51899823 GGGAATGTCTACTGTGGGGATGG - Intronic
1191210654 X:57881795-57881817 GTGAATGTCAGAGGTGGGGAAGG + Intergenic
1194588188 X:95763516-95763538 TAGAAGGCCTAAGGTGTGGGTGG + Intergenic
1195934998 X:110116687-110116709 AAGAATTTCTTATGTGTGGATGG + Intronic
1197063401 X:122210013-122210035 GAGAATATCTAAAGTGTTGAAGG + Intergenic
1198030186 X:132747134-132747156 GATAAAGGCTAAGGTGAGGAGGG + Intronic
1199542981 X:148978389-148978411 GAGAATGTTTAAGCTGAAGAAGG + Exonic