ID: 1131076072

View in Genome Browser
Species Human (GRCh38)
Location 15:89495788-89495810
Sequence CGTGGCTCTTGCCACAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131076072_1131076078 13 Left 1131076072 15:89495788-89495810 CCTGGTTTGTGGCAAGAGCCACG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1131076078 15:89495824-89495846 AAGGGAGGTGTGTGATTGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1131076072_1131076077 12 Left 1131076072 15:89495788-89495810 CCTGGTTTGTGGCAAGAGCCACG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1131076077 15:89495823-89495845 AAAGGGAGGTGTGTGATTGTAGG 0: 1
1: 0
2: 1
3: 26
4: 266
1131076072_1131076073 -6 Left 1131076072 15:89495788-89495810 CCTGGTTTGTGGCAAGAGCCACG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1131076073 15:89495805-89495827 GCCACGAGAGCATGAGAGAAAGG 0: 1
1: 0
2: 0
3: 13
4: 141
1131076072_1131076076 -2 Left 1131076072 15:89495788-89495810 CCTGGTTTGTGGCAAGAGCCACG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1131076076 15:89495809-89495831 CGAGAGCATGAGAGAAAGGGAGG 0: 1
1: 0
2: 4
3: 95
4: 939
1131076072_1131076075 -5 Left 1131076072 15:89495788-89495810 CCTGGTTTGTGGCAAGAGCCACG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1131076075 15:89495806-89495828 CCACGAGAGCATGAGAGAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131076072 Original CRISPR CGTGGCTCTTGCCACAAACC AGG (reversed) Intronic