ID: 1131076512

View in Genome Browser
Species Human (GRCh38)
Location 15:89498711-89498733
Sequence GTGGCCACACTGTGCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131076510_1131076512 4 Left 1131076510 15:89498684-89498706 CCTAATCAGGGTGCTTGGAACTT No data
Right 1131076512 15:89498711-89498733 GTGGCCACACTGTGCCAGCTTGG No data
1131076506_1131076512 30 Left 1131076506 15:89498658-89498680 CCATGTATAACATCTGAGGCTAA No data
Right 1131076512 15:89498711-89498733 GTGGCCACACTGTGCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131076512 Original CRISPR GTGGCCACACTGTGCCAGCT TGG Intergenic
No off target data available for this crispr