ID: 1131076518

View in Genome Browser
Species Human (GRCh38)
Location 15:89498725-89498747
Sequence GATACCCTGGTACCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131076518_1131076520 -10 Left 1131076518 15:89498725-89498747 CCAGCTTGGGGTACCAGGGTATC No data
Right 1131076520 15:89498738-89498760 CCAGGGTATCCCCACTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131076518 Original CRISPR GATACCCTGGTACCCCAAGC TGG (reversed) Intergenic
No off target data available for this crispr