ID: 1131076639

View in Genome Browser
Species Human (GRCh38)
Location 15:89499385-89499407
Sequence CATCAAGGAGTCCCCCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131076639_1131076650 -8 Left 1131076639 15:89499385-89499407 CCCCCTTGGGGGACTCCTTGATG No data
Right 1131076650 15:89499400-89499422 CCTTGATGGGGCAGGGTACAGGG No data
1131076639_1131076651 -2 Left 1131076639 15:89499385-89499407 CCCCCTTGGGGGACTCCTTGATG No data
Right 1131076651 15:89499406-89499428 TGGGGCAGGGTACAGGGTCCAGG No data
1131076639_1131076648 -9 Left 1131076639 15:89499385-89499407 CCCCCTTGGGGGACTCCTTGATG No data
Right 1131076648 15:89499399-89499421 TCCTTGATGGGGCAGGGTACAGG No data
1131076639_1131076653 30 Left 1131076639 15:89499385-89499407 CCCCCTTGGGGGACTCCTTGATG No data
Right 1131076653 15:89499438-89499460 CTGACTCACAAGCCCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131076639 Original CRISPR CATCAAGGAGTCCCCCAAGG GGG (reversed) Intergenic
No off target data available for this crispr