ID: 1131076666

View in Genome Browser
Species Human (GRCh38)
Location 15:89499511-89499533
Sequence GGCAAACGGCCTTCTTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131076666_1131076673 18 Left 1131076666 15:89499511-89499533 CCAGCACAAGAAGGCCGTTTGCC No data
Right 1131076673 15:89499552-89499574 TAGACTCAAGGTACAAACGATGG No data
1131076666_1131076668 -5 Left 1131076666 15:89499511-89499533 CCAGCACAAGAAGGCCGTTTGCC No data
Right 1131076668 15:89499529-89499551 TTGCCCTTGACCTTCATATTTGG No data
1131076666_1131076674 19 Left 1131076666 15:89499511-89499533 CCAGCACAAGAAGGCCGTTTGCC No data
Right 1131076674 15:89499553-89499575 AGACTCAAGGTACAAACGATGGG No data
1131076666_1131076672 6 Left 1131076666 15:89499511-89499533 CCAGCACAAGAAGGCCGTTTGCC No data
Right 1131076672 15:89499540-89499562 CTTCATATTTGGTAGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131076666 Original CRISPR GGCAAACGGCCTTCTTGTGC TGG (reversed) Intergenic
No off target data available for this crispr