ID: 1131079545

View in Genome Browser
Species Human (GRCh38)
Location 15:89523236-89523258
Sequence ACAGTGCCAGGTGGGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131079545_1131079556 20 Left 1131079545 15:89523236-89523258 CCTCTGTCCCCACCTGGCACTGT No data
Right 1131079556 15:89523279-89523301 CATTTGTTCCCACGTATCAGGGG No data
1131079545_1131079553 18 Left 1131079545 15:89523236-89523258 CCTCTGTCCCCACCTGGCACTGT No data
Right 1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG No data
1131079545_1131079555 19 Left 1131079545 15:89523236-89523258 CCTCTGTCCCCACCTGGCACTGT No data
Right 1131079555 15:89523278-89523300 CCATTTGTTCCCACGTATCAGGG No data
1131079545_1131079550 -6 Left 1131079545 15:89523236-89523258 CCTCTGTCCCCACCTGGCACTGT No data
Right 1131079550 15:89523253-89523275 CACTGTGTATGCATAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131079545 Original CRISPR ACAGTGCCAGGTGGGGACAG AGG (reversed) Intergenic
No off target data available for this crispr