ID: 1131079546

View in Genome Browser
Species Human (GRCh38)
Location 15:89523243-89523265
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131079546_1131079555 12 Left 1131079546 15:89523243-89523265 CCCCACCTGGCACTGTGTATGCA No data
Right 1131079555 15:89523278-89523300 CCATTTGTTCCCACGTATCAGGG No data
1131079546_1131079553 11 Left 1131079546 15:89523243-89523265 CCCCACCTGGCACTGTGTATGCA No data
Right 1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG No data
1131079546_1131079556 13 Left 1131079546 15:89523243-89523265 CCCCACCTGGCACTGTGTATGCA No data
Right 1131079556 15:89523279-89523301 CATTTGTTCCCACGTATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131079546 Original CRISPR TGCATACACAGTGCCAGGTG GGG (reversed) Intergenic
No off target data available for this crispr