ID: 1131079553

View in Genome Browser
Species Human (GRCh38)
Location 15:89523277-89523299
Sequence CCCATTTGTTCCCACGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131079543_1131079553 28 Left 1131079543 15:89523226-89523248 CCAACACTGGCCTCTGTCCCCAC No data
Right 1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG No data
1131079548_1131079553 9 Left 1131079548 15:89523245-89523267 CCACCTGGCACTGTGTATGCATA No data
Right 1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG No data
1131079549_1131079553 6 Left 1131079549 15:89523248-89523270 CCTGGCACTGTGTATGCATAAAC No data
Right 1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG No data
1131079546_1131079553 11 Left 1131079546 15:89523243-89523265 CCCCACCTGGCACTGTGTATGCA No data
Right 1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG No data
1131079547_1131079553 10 Left 1131079547 15:89523244-89523266 CCCACCTGGCACTGTGTATGCAT No data
Right 1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG No data
1131079545_1131079553 18 Left 1131079545 15:89523236-89523258 CCTCTGTCCCCACCTGGCACTGT No data
Right 1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131079553 Original CRISPR CCCATTTGTTCCCACGTATC AGG Intergenic
No off target data available for this crispr