ID: 1131083246

View in Genome Browser
Species Human (GRCh38)
Location 15:89554474-89554496
Sequence CTGTAGACACTGTTTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131083241_1131083246 3 Left 1131083241 15:89554448-89554470 CCACAACGGTCTGGGATTACACT No data
Right 1131083246 15:89554474-89554496 CTGTAGACACTGTTTGGCCAGGG No data
1131083240_1131083246 4 Left 1131083240 15:89554447-89554469 CCCACAACGGTCTGGGATTACAC No data
Right 1131083246 15:89554474-89554496 CTGTAGACACTGTTTGGCCAGGG No data
1131083239_1131083246 9 Left 1131083239 15:89554442-89554464 CCAGTCCCACAACGGTCTGGGAT No data
Right 1131083246 15:89554474-89554496 CTGTAGACACTGTTTGGCCAGGG No data
1131083235_1131083246 29 Left 1131083235 15:89554422-89554444 CCTGGCTAGAAAAAGGAGGGCCA No data
Right 1131083246 15:89554474-89554496 CTGTAGACACTGTTTGGCCAGGG No data
1131083234_1131083246 30 Left 1131083234 15:89554421-89554443 CCCTGGCTAGAAAAAGGAGGGCC No data
Right 1131083246 15:89554474-89554496 CTGTAGACACTGTTTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131083246 Original CRISPR CTGTAGACACTGTTTGGCCA GGG Intergenic
No off target data available for this crispr