ID: 1131086818

View in Genome Browser
Species Human (GRCh38)
Location 15:89582689-89582711
Sequence TGGGAATCCCCAGACCACCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131086814_1131086818 23 Left 1131086814 15:89582643-89582665 CCTAATTTATAGTAACCTAAGGT 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1131086818 15:89582689-89582711 TGGGAATCCCCAGACCACCTTGG 0: 1
1: 0
2: 1
3: 15
4: 174
1131086815_1131086818 8 Left 1131086815 15:89582658-89582680 CCTAAGGTTGTTTGTCGTTTTAT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1131086818 15:89582689-89582711 TGGGAATCCCCAGACCACCTTGG 0: 1
1: 0
2: 1
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131086818 Original CRISPR TGGGAATCCCCAGACCACCT TGG Exonic
900465066 1:2821556-2821578 CTGAAATCCCCAGCCCACCTGGG + Intergenic
900487278 1:2929155-2929177 TGGGCCACCCCAGGCCACCTTGG - Intergenic
901917498 1:12511267-12511289 ATGGAATCCAAAGACCACCTAGG + Exonic
902808251 1:18874055-18874077 TGGGAAACCCCAGCACGCCTGGG + Intronic
903125469 1:21244571-21244593 TGGGAAACCCCAGGCCAGGTGGG - Intronic
904033011 1:27544840-27544862 TGGAATTCCCCAGGCCACCGTGG - Intronic
905943505 1:41883175-41883197 TGTGAGTCCTCAGACCTCCTAGG - Intronic
906541167 1:46587217-46587239 TGGGAGCCTCCAGACCAGCTGGG - Intronic
909052872 1:70788423-70788445 AGGGAATCCACTGACTACCTTGG + Intergenic
910127567 1:83860753-83860775 CGGGACGCCCCGGACCACCTGGG - Intergenic
910376652 1:86579391-86579413 TGAGGATACTCAGACCACCTTGG + Exonic
910478550 1:87634285-87634307 TGGGTTTCCCAAGACCACCCTGG - Intergenic
911005320 1:93215338-93215360 TAGCAAACCCCAAACCACCTAGG + Intronic
912519104 1:110233370-110233392 TGGGAATTGCCAGTCCAGCTGGG + Exonic
913325864 1:117628229-117628251 GAGGAATCCCCAGACCTCCTAGG - Exonic
915217209 1:154348406-154348428 AGGGAATGCCCAGAACACCTTGG + Exonic
915289207 1:154871561-154871583 GGGAATTCCCCAGAACACCTGGG + Intergenic
915471563 1:156128858-156128880 TGGGAAGCCCCAGCCAGCCTGGG + Intronic
917478354 1:175387932-175387954 TGAAAATCACCAGACCACTTGGG + Intronic
917622970 1:176817044-176817066 TAGGAATCCCCAGTCTGCCTTGG + Intronic
917632590 1:176904691-176904713 TGTGCATCCCCAGACCACTCAGG + Intronic
918478578 1:184952481-184952503 TGGGATTCCCCGGGCCACATTGG + Intronic
920656643 1:207881182-207881204 AGGGAACCCCCAGAGGACCTTGG - Intergenic
923108527 1:230872444-230872466 TGGGATGCCCTATACCACCTGGG + Intergenic
924472334 1:244353575-244353597 TGTGAATTCCCAGAGCCCCTGGG - Intronic
1064138591 10:12771418-12771440 TGGGAAACTCCAGATGACCTTGG + Intronic
1065417019 10:25499402-25499424 TGAGATTCCACATACCACCTTGG - Intronic
1065926053 10:30434427-30434449 TGGGAATCCCCGGGGCACCCAGG - Intronic
1067941351 10:50659646-50659668 TGGAGATCCCCAGCCCAACTTGG + Intergenic
1069765015 10:70849721-70849743 TGGGAATTTCCAGATCTCCTAGG + Intronic
1070862588 10:79684608-79684630 TGGAGATCCCCAGCCCAACTTGG + Intergenic
1071504371 10:86223699-86223721 GGGCAATCCCCAGCCCAGCTTGG + Intronic
1073377526 10:103049362-103049384 TGGGAATCCCTAGGGCACCATGG + Intronic
1075599347 10:123756023-123756045 TGGGTATCCCAAGACCATCATGG + Intronic
1076343238 10:129764324-129764346 GGGGAAGCCCCAGCCCCCCTTGG - Intronic
1076602470 10:131667734-131667756 GGAGAATCCCCGGGCCACCTTGG + Intergenic
1078526541 11:12105768-12105790 TGTGAATCCCCAGTCTATCTGGG + Intronic
1084440023 11:69167506-69167528 TAGGTCTCCCCAGACCACCTGGG + Intergenic
1084561971 11:69910381-69910403 TGGGGATCCCCAGGACCCCTCGG - Intergenic
1085051707 11:73383325-73383347 TGGGAATTCCCAGACTTCCCCGG + Intronic
1092710028 12:11326249-11326271 GGGGAATCCCCTGACCACAGGGG - Intergenic
1093247957 12:16763204-16763226 TATTAATCCCCAGACCTCCTGGG - Intergenic
1096525817 12:52209668-52209690 TGGGACCCCAGAGACCACCTAGG + Intergenic
1097167153 12:57092000-57092022 TGAGAACCCCCAGGCCTCCTAGG + Intronic
1097276396 12:57816239-57816261 TGGTAATCCCCAGGCCAGCCAGG - Exonic
1099673825 12:85731143-85731165 TGGAAATCTCCAGAACTCCTAGG + Intergenic
1101749593 12:107572497-107572519 AGGGAGTCTCCAGATCACCTAGG - Intronic
1103221093 12:119246234-119246256 TGGGAATCCCAACACAAACTGGG - Intergenic
1103342856 12:120230319-120230341 TGGGCATCCCCAGACCCCCTAGG - Intronic
1103925634 12:124422241-124422263 TGGGAATCCCGAGAACCCCAGGG - Intronic
1104848752 12:131860910-131860932 TGGGGATCTCCAGGCCACCGTGG + Intergenic
1108115387 13:47121765-47121787 TGGAAATGCCCAGAACATCTGGG + Intergenic
1108568942 13:51730417-51730439 TGGGAAACCGCAGACCACAGTGG - Intronic
1109087452 13:57993243-57993265 TGGCAATCCCAAGATCATCTAGG + Intergenic
1109835407 13:67850487-67850509 TGGGCATCCCCAGGCCACATTGG + Intergenic
1115012503 14:28566503-28566525 AGGGAATCCCCAGATTCCCTTGG + Intergenic
1116263862 14:42662976-42662998 TTGGAATCCCCAAAATACCTGGG + Intergenic
1125492461 15:40158454-40158476 TGAAAACACCCAGACCACCTAGG - Intergenic
1128622145 15:69160152-69160174 TGGGAATCCCCAGCGCACTTCGG + Intergenic
1130706053 15:86233908-86233930 TGGGAACACCCTGGCCACCTTGG - Intronic
1131086818 15:89582689-89582711 TGGGAATCCCCAGACCACCTTGG + Exonic
1132311732 15:100862351-100862373 GGGGAATCCCCAGGCCAGCAGGG + Intergenic
1135527951 16:23228333-23228355 TCGGAATCTCCAGACCCCCTCGG + Intergenic
1138577683 16:57918979-57919001 TGGGAGGCCACAGACAACCTGGG - Intronic
1138973074 16:62170300-62170322 TGGGAAACCCCAGCCCAATTTGG - Intergenic
1140738188 16:77917842-77917864 TCTGAATCCCCAGACCTCCCTGG + Intronic
1140809682 16:78565553-78565575 TGGGAATACCCAGATAATCTTGG + Intronic
1141860525 16:86713245-86713267 AGGGAAGCCCCAGACCCCCCTGG - Intergenic
1143101357 17:4506427-4506449 AGGGACTCCCAAGACCACCAGGG - Intronic
1144467564 17:15508520-15508542 TGGGACTCCCCAGTCCTCCGAGG - Intronic
1146643855 17:34563338-34563360 TGGGCATCCCCAGATCAGGTGGG + Intergenic
1146956785 17:36940627-36940649 TGGGAATCCGGAGACAAACTGGG - Exonic
1147323421 17:39659178-39659200 TGGGAAACCCCTGCCCACCCCGG - Intronic
1147327932 17:39678758-39678780 TGGGAAGCCCAAGAGCAACTGGG + Intronic
1150632758 17:66891660-66891682 TCATAATCCCCAGACAACCTAGG + Intergenic
1151281366 17:73077122-73077144 TGTGACTGCCCAGGCCACCTGGG + Intronic
1152310672 17:79547956-79547978 TGGCCATCCCCTGACCTCCTGGG + Intergenic
1153234333 18:2971301-2971323 TGTGAATCCCCAGAGCACAAAGG + Intronic
1154148720 18:11888469-11888491 TGGGAAACCTCAAACCACCCTGG - Intronic
1154168831 18:12036270-12036292 AGGGAATCCCCTGCCAACCTTGG + Intergenic
1155607710 18:27626288-27626310 TGGGATGCCCTGGACCACCTTGG + Intergenic
1158003309 18:52644182-52644204 TGAGCATCACCAGACCCCCTTGG + Intronic
1158546841 18:58404379-58404401 GGGGAATGGACAGACCACCTTGG + Intergenic
1158613340 18:58962951-58962973 TGGGAACACTCATACCACCTGGG + Intronic
1160628203 18:80227834-80227856 CGGGAACCACCAGACCACCAGGG + Intronic
1160628215 18:80227885-80227907 CGGGAACCACCAGACCACCAGGG + Intronic
1161161209 19:2762727-2762749 TGGCAACCCCCAAACCACCTCGG + Intronic
1163157890 19:15449290-15449312 TGGGAATCCCCAGGCCCCCGAGG - Intronic
1164889930 19:31814650-31814672 TGGGTGTTCCGAGACCACCTGGG + Intergenic
1165306510 19:35005956-35005978 TGGGATTCCCTCCACCACCTGGG - Intronic
1166169819 19:41019747-41019769 TGGGATTCCACAGACAAGCTTGG + Intergenic
1167280974 19:48568386-48568408 TGGGTCTTCCCTGACCACCTTGG - Intronic
1168167991 19:54566823-54566845 TGGTAATCCCCAGAACCCATGGG + Intergenic
1168441490 19:56371507-56371529 AGGAAATCCCCAAACCACCGTGG + Intergenic
926197393 2:10772212-10772234 TGGGAATCACCAGACTTCCCAGG - Intronic
927054195 2:19354978-19355000 TTGGCATCTCCAGACCTCCTTGG + Intronic
928122455 2:28592736-28592758 TAGTTATCCCCAAACCACCTGGG - Intronic
928313718 2:30231060-30231082 TGGCTGTCCCCAGCCCACCTCGG - Intergenic
931550517 2:63440846-63440868 GGGGAATCCCCCACCCACCTAGG + Intronic
935695656 2:105768845-105768867 TGGGAGTCCCCATGCCCCCTGGG + Intronic
935829555 2:106986792-106986814 TAGGAATCCCAAGAGCATCTTGG + Intergenic
937052817 2:118906226-118906248 TGAGAATCCCCAGCCCTCCCAGG + Intergenic
937287052 2:120760327-120760349 TGGGAGGCCCCAGACCTCCTTGG - Intronic
939344673 2:140948863-140948885 AGGGAATCCGCAGAACAGCTGGG + Intronic
943367229 2:186977771-186977793 TGGGGATCCACAGGCCACCAAGG - Intergenic
944918944 2:204390451-204390473 TAGGAAGCCCCTTACCACCTAGG + Intergenic
945037431 2:205716224-205716246 AGTGAATCCGCAGACCTCCTGGG + Exonic
946200575 2:218068676-218068698 AGGGAAGCCCCAGCCCACCTGGG + Intronic
947540415 2:230973615-230973637 GGGGAACCCCCAGGCTACCTAGG - Intergenic
1169122729 20:3107054-3107076 TGCGAGGCCCCAGAGCACCTGGG - Intergenic
1169613976 20:7417717-7417739 AGGGGATTCCCAGACCATCTTGG - Intergenic
1169746498 20:8948312-8948334 TGGGAAGCCTCAGACCTCTTGGG + Intronic
1170775461 20:19371346-19371368 CGGTGATCCCCAGACCTCCTGGG - Intronic
1171387279 20:24778883-24778905 TCGGAATCAGCAGAGCACCTCGG + Intergenic
1173008859 20:39162962-39162984 ATTGAATCCACAGACCACCTTGG - Intergenic
1174999764 20:55614312-55614334 TGCAAATTCCCAGACCAGCTGGG - Intergenic
1175703997 20:61162397-61162419 TGGCATTGCCCAGACCACCACGG + Intergenic
1176153101 20:63603231-63603253 TGGGCATGCCCTGCCCACCTTGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1180171467 21:46060895-46060917 TGGAAATCCCCAGAGGACCCAGG - Intergenic
1181374833 22:22449021-22449043 TGGGAATCCTCAGACCTCACAGG - Intergenic
1183653852 22:39173942-39173964 TGGGGAGCCCCATACCCCCTGGG + Intergenic
1184348218 22:43925796-43925818 TGGGTGTCCACAGGCCACCTTGG - Intronic
1184405662 22:44299036-44299058 TGGGAGCCCCCAGCCCGCCTTGG - Intronic
1184675046 22:46037030-46037052 TGGGAATCTCCAGGCAACCTGGG - Intergenic
1184957755 22:47903040-47903062 TGGGGATCCCTAGACCCCCAGGG - Intergenic
950096817 3:10335458-10335480 CAGGGATCCCCAGGCCACCTAGG - Intronic
952205043 3:31172834-31172856 TGGGAATTACCAGACAACTTTGG - Intergenic
952919014 3:38271912-38271934 TGGGATTCTGCAGACCACCATGG + Intronic
954333350 3:49902432-49902454 TGTGAATCCCCAGTCCATCCAGG - Exonic
956004278 3:64762140-64762162 TGGGTATCCCCAGGCCACCAGGG - Intergenic
958665608 3:97133777-97133799 TATGAATCCCTATACCACCTAGG + Intronic
961077290 3:123993713-123993735 TGGCCATCCCCAGACCATCCAGG - Intergenic
962377818 3:134873408-134873430 CAGGAATCCCCAAACCATCTAGG - Intronic
965334354 3:167417975-167417997 TGGGGCTCCAAAGACCACCTCGG + Intergenic
965747657 3:171942351-171942373 TGGGAAACTCCAAGCCACCTTGG - Intergenic
967121753 3:186388526-186388548 TGTGGATCCCCAGATCAGCTGGG + Intergenic
970137497 4:12941643-12941665 TGAGAATACTCAGACAACCTAGG - Intergenic
972560892 4:40227627-40227649 GGGGAATTCCCAGAATACCTGGG + Intronic
972600066 4:40564291-40564313 TGGCAATGCCCAGGCAACCTTGG + Intronic
978154166 4:105471280-105471302 TGGGAATCATCAGGCCTCCTTGG - Intronic
981490170 4:145331198-145331220 TCAGAAGCCCCAGGCCACCTTGG + Intergenic
982289478 4:153765415-153765437 TGGGCCTCCCCACACAACCTAGG - Intergenic
985325341 4:188761838-188761860 TGGGAAACCCCAGTTGACCTGGG + Intergenic
985591120 5:766053-766075 TGAGAAACCCCAGGCCCCCTAGG - Intronic
986237843 5:5928435-5928457 TGGGACTCCCCCCACCCCCTGGG + Intergenic
986239260 5:5942824-5942846 TGGGCTTTCCCTGACCACCTAGG + Intergenic
990886462 5:60599981-60600003 AGGGAATGCCGAGACCAGCTCGG - Intronic
995345644 5:111113762-111113784 TGTGATTCTCCATACCACCTTGG - Intronic
997671622 5:135679386-135679408 TGGGGATCACCCTACCACCTGGG - Intergenic
998001512 5:138629656-138629678 TGGGAAACCACAGACAGCCTGGG + Intronic
1000336876 5:160247966-160247988 AGGGAATCCCCTGACTACCGAGG + Intergenic
1002318052 5:178357164-178357186 TGGGAAGCCCCAGGTCACCAGGG - Intronic
1004596250 6:17102389-17102411 TGGGAATCGCGAGACCTCCCAGG - Intronic
1005531858 6:26715689-26715711 TGGTGATCCCTAGACCACTTAGG + Intergenic
1005538937 6:26785976-26785998 TGGTGATCCCTAGACCACTTAGG - Intergenic
1005992739 6:30913724-30913746 TGGGAATCCCCCCAGCTCCTTGG - Intronic
1006155179 6:32009855-32009877 AGGGGATCCGCAGCCCACCTGGG + Intergenic
1006161485 6:32042589-32042611 AGGGGATCCGCAGCCCACCTGGG + Exonic
1006460163 6:34153412-34153434 TGGGAACCCCAAGACTGCCTTGG + Intronic
1007111319 6:39314784-39314806 TGTCAATCTCAAGACCACCTTGG + Intronic
1007260415 6:40559435-40559457 TGGGAATCCCCAGTTCAGCTGGG + Intronic
1009009778 6:57828203-57828225 TGGTGATCCCTAGACCACTTAGG - Intergenic
1011078813 6:83466944-83466966 TGGCAATTCCCAGAGCTCCTTGG - Intergenic
1013819711 6:114139768-114139790 TGGGAGTCAAGAGACCACCTGGG + Intronic
1014255275 6:119155204-119155226 TGGGAATGTCCAGAGCACCCAGG - Intergenic
1015984836 6:138874581-138874603 TGGACCCCCCCAGACCACCTTGG - Intronic
1017040196 6:150302103-150302125 TGGGCAACCTCAGACCACCCAGG + Intergenic
1017967492 6:159279129-159279151 TGGGCACTCCCAGACCAGCTTGG - Intergenic
1018751897 6:166813640-166813662 TGGGAATCCCCAGGGACCCTTGG + Intronic
1019358859 7:594700-594722 GGGGACTCCCCAGACCACAAGGG + Intronic
1019358917 7:594892-594914 TGAGGGTCCCCAGACCACCAAGG + Intronic
1021938227 7:25652725-25652747 TGGGCATGCACATACCACCTGGG - Intergenic
1022985412 7:35649528-35649550 AGGGTATCCCCTGACCACCTTGG - Intronic
1024055353 7:45657012-45657034 TGGGAAACCCCAGGCCAGCCTGG - Intronic
1030406353 7:109119052-109119074 TGGGTACCACCAGACCACGTAGG - Intergenic
1031134676 7:117872836-117872858 TGGGCATCCCCACACCTGCTGGG + Intronic
1031730587 7:125295330-125295352 AGGGAATCCGCAGATCACTTTGG - Intergenic
1033126570 7:138712166-138712188 AGGTAATCCCCCCACCACCTTGG + Intronic
1037824780 8:22154758-22154780 GGGGAATCCCTGGGCCACCTGGG + Intronic
1040615229 8:49029028-49029050 TGGGAATCCCCAGACCTCACAGG - Intergenic
1042859464 8:73297865-73297887 TGGGAGTGCCCAGGCCACCCTGG + Intronic
1050066027 9:1760236-1760258 AGAAATTCCCCAGACCACCTCGG - Intergenic
1051563669 9:18471656-18471678 TGGGAATACCCAGAGAAACTAGG - Intergenic
1057141845 9:92731137-92731159 TGGGCAGCGCCAGACCATCTGGG + Intronic
1059359862 9:113733836-113733858 TGGGAATCAGGAGACCAGCTAGG + Intergenic
1188110623 X:26193069-26193091 CGGGGACACCCAGACCACCTAGG - Intronic
1189369130 X:40413927-40413949 TGGAACTCCCTGGACCACCTAGG - Intergenic
1191671470 X:63752296-63752318 TGGGAATCCCAAACCCACCGAGG + Intronic
1198891708 X:141403731-141403753 AGGAAATCCCTAGACCACCATGG - Intergenic
1199717779 X:150518536-150518558 TGGGCAGGCCCAGACCACCCAGG + Intergenic