ID: 1131086875

View in Genome Browser
Species Human (GRCh38)
Location 15:89583357-89583379
Sequence CTGGTAACAAGCATCATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131086875_1131086878 -5 Left 1131086875 15:89583357-89583379 CCCAGAATGATGCTTGTTACCAG 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1131086878 15:89583375-89583397 ACCAGGAAAAGCAAACATGTTGG 0: 1
1: 0
2: 1
3: 36
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131086875 Original CRISPR CTGGTAACAAGCATCATTCT GGG (reversed) Intronic
904766098 1:32848528-32848550 CTGGTACCAGGCAGCCTTCTAGG + Intronic
909883631 1:80912437-80912459 CTGCAAACAAGCACCATGCTAGG + Intergenic
911569207 1:99502308-99502330 CTGGTACCAAGTTTTATTCTAGG - Intergenic
916557123 1:165902817-165902839 CTGTTAACAAGAAGCAATCTGGG - Intronic
917444071 1:175091966-175091988 ATGGTAGCAAGCACCAATCTGGG + Intronic
918273620 1:182928298-182928320 CATGTACCAAGCATCATGCTAGG + Intronic
923859427 1:237878155-237878177 CTGGTAACAAGAATAATGGTAGG - Exonic
1068174360 10:53438930-53438952 CAGTTAACAAGCATCCTTCCTGG + Intergenic
1068792973 10:61047537-61047559 CTTGTCACAATCATGATTCTGGG + Intergenic
1069006260 10:63320866-63320888 TTGGTAACAAGCACCATCCTGGG - Intronic
1071079985 10:81799253-81799275 CTGGTTTGGAGCATCATTCTGGG + Intergenic
1071150108 10:82623920-82623942 CTGGCAACAGGAAGCATTCTGGG - Intronic
1076176075 10:128368937-128368959 CTGAGAATAAGCATCATTTTGGG + Intergenic
1077650116 11:3963745-3963767 CTGGTAACATTCAACATACTGGG - Intronic
1077963549 11:7101647-7101669 ATGGCAACAAGCACTATTCTTGG + Intergenic
1078974861 11:16462053-16462075 CAGGTACAAAGCATTATTCTTGG + Intronic
1081278014 11:41174622-41174644 CAGTTAACCAGCATCATCCTGGG + Intronic
1082818087 11:57523734-57523756 CTTGTGACAAGCATCGTTTTAGG - Intergenic
1082908534 11:58341926-58341948 CTGGAAGAAAACATCATTCTGGG + Intergenic
1083149200 11:60781244-60781266 CTGAACCCAAGCATCATTCTTGG + Intergenic
1083438091 11:62656832-62656854 CTATTACCAAGCATCATTCTAGG + Intronic
1086451395 11:86920510-86920532 CTGGGGACAAACATCATACTAGG + Intronic
1087540877 11:99517898-99517920 CTGGTAACTAGCATATTTCTTGG + Intronic
1087832037 11:102829828-102829850 CAGCTATCAAACATCATTCTGGG + Intergenic
1088415255 11:109581501-109581523 GTGGTTAGAAGCATCATTTTTGG - Intergenic
1089374588 11:117985759-117985781 CTGGTTAAAAGCCTCTTTCTTGG + Intergenic
1089737698 11:120561452-120561474 CTGGTGACAGGCAGCACTCTAGG + Intronic
1093137840 12:15473309-15473331 CGGGCAACAGGCATCATGCTAGG - Intronic
1095734024 12:45536621-45536643 CTTGTAACAAGAATCATTTAAGG + Intergenic
1098119724 12:67223139-67223161 CTGCTACCAAGCATAATTCATGG + Intergenic
1098476779 12:70913896-70913918 TAGGTAACAAGCATAGTTCTAGG + Intronic
1099914838 12:88879780-88879802 AACGTAACAAGAATCATTCTAGG - Intergenic
1101333934 12:103779729-103779751 GTGGTATAAAGCATCCTTCTAGG + Intronic
1103830650 12:123776322-123776344 CTGGGACCAAGAGTCATTCTTGG - Intronic
1106908491 13:34436001-34436023 CTGGTAATAAAAATCATTTTGGG - Intergenic
1109350191 13:61170202-61170224 CTGGAAACAAGTATGTTTCTAGG - Intergenic
1109722648 13:66295405-66295427 TTGGTACCAGGCATGATTCTAGG + Intergenic
1111825842 13:93266013-93266035 CTGGTAACAATCAGCTTTCCAGG - Intronic
1112637112 13:101227358-101227380 CTGGCAAGAAGGGTCATTCTCGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114513478 14:23281605-23281627 CTGAGGACAAGCAGCATTCTAGG - Intronic
1117929139 14:60821388-60821410 CTAGAGACAAACATCATTCTAGG - Intronic
1121245033 14:92456109-92456131 CTGGTGACAGCCATCATTCGGGG - Intronic
1123953270 15:25305959-25305981 CTAGTAACCAGCATGAGTCTGGG + Intergenic
1127961399 15:63893543-63893565 CTGGAAAGAAGCATCATACCTGG - Intergenic
1131086875 15:89583357-89583379 CTGGTAACAAGCATCATTCTGGG - Intronic
1131102053 15:89700235-89700257 GTGGAAACAGGCATTATTCTTGG + Intronic
1131735154 15:95324243-95324265 CTAGAAACAAGAATCATTATAGG + Intergenic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1137704846 16:50527529-50527551 CTGGTAGCACGCATCAGGCTGGG + Intergenic
1138811980 16:60161743-60161765 TTTGTAGCAAGCAACATTCTAGG + Intergenic
1143708061 17:8714169-8714191 TTTGTACCAAGCACCATTCTAGG + Intergenic
1143826133 17:9609180-9609202 GGGGTACCAGGCATCATTCTAGG + Intronic
1143889056 17:10088382-10088404 CTGCCAACAACCATCATTTTTGG + Intronic
1146059237 17:29595890-29595912 CTGGATACAAGCCTCACTCTGGG - Intronic
1146771916 17:35576864-35576886 CTGGTAACCTTCATCATTCTAGG - Intronic
1148595157 17:48848334-48848356 CTGGTAATACTCATCATCCTTGG - Exonic
1149016034 17:51909358-51909380 ATGGTAACAAGCTGGATTCTCGG - Intronic
1151024898 17:70666947-70666969 CTTGAAACAAGAATCATTATGGG + Intergenic
1153104488 18:1511228-1511250 CTGCTTACAACCATCATTCATGG - Intergenic
1156618876 18:38824677-38824699 CTGTTAACATGCATTACTCTTGG - Intergenic
1162487488 19:10970134-10970156 CTGGTAACCAGCCCCATCCTGGG - Intronic
1164401756 19:27906988-27907010 CATGTGACAAACATCATTCTAGG + Intergenic
1165543958 19:36517774-36517796 CTAGTAACCACCAGCATTCTCGG - Intronic
925926144 2:8672055-8672077 CTGGTACCATTCATCATACTTGG + Intergenic
926819480 2:16836947-16836969 CAGGTAGCATGTATCATTCTTGG - Intergenic
927709713 2:25316865-25316887 CTGTTAACAAACATTATTCATGG - Intronic
930265196 2:49191489-49191511 CTTGTCACCAGCATCCTTCTTGG + Intergenic
932325470 2:70857004-70857026 ATGGAAACAGGCACCATTCTAGG - Intergenic
933250157 2:80020461-80020483 CTGAAAAAAAGCATCATTTTGGG - Intronic
935044663 2:99469815-99469837 CTGGTGATAAACATAATTCTCGG - Intronic
938779134 2:134568985-134569007 CTGGTAACCAGCGTCACTGTGGG - Intronic
939275999 2:139996806-139996828 CTGGTGCCAAGCATTGTTCTAGG - Intergenic
945167797 2:206964713-206964735 CTGGGAAAAAGGAGCATTCTGGG - Intronic
946798518 2:223383450-223383472 CTGGCAATAACCAGCATTCTGGG + Intergenic
947130269 2:226915567-226915589 CAGGTACCAAGCATTATGCTAGG + Intronic
947455110 2:230247007-230247029 CTGCTAACATGTCTCATTCTTGG - Intronic
1172518799 20:35554225-35554247 CAGCTAACAAGCCTCCTTCTGGG - Intronic
1173579651 20:44137924-44137946 CTGGTACCACCTATCATTCTTGG - Intronic
1176984412 21:15419879-15419901 CTCGTAAGAAGCAGCAGTCTAGG + Intergenic
1178127827 21:29534679-29534701 CTGGTAACAACCATTAACCTTGG - Intronic
1178272588 21:31205663-31205685 ATGGTAATAAGAATGATTCTTGG + Intronic
1179072795 21:38088622-38088644 CTGGTATCCAGCATTGTTCTGGG - Intronic
1180064905 21:45407328-45407350 ATGGAAAGATGCATCATTCTTGG - Intronic
952338552 3:32425837-32425859 CTGGTCACAAGCATAAAACTGGG + Intronic
952740261 3:36727940-36727962 CTGGGAAGAAGAATTATTCTAGG - Intronic
958187762 3:90145211-90145233 CTTGTCACATGCATCATGCTGGG - Intergenic
959397439 3:105858492-105858514 TTAGTACCAAGCTTCATTCTAGG - Intronic
960480746 3:118186113-118186135 CTGGCTACCAGTATCATTCTTGG + Intergenic
960803990 3:121565095-121565117 CTGGTAACAAGCACTATTCTGGG - Intergenic
961842334 3:129725759-129725781 TTGGTAATAACCACCATTCTGGG - Intronic
961908318 3:130285943-130285965 ATGGTAACAGACATCAGTCTAGG - Intergenic
962100097 3:132332943-132332965 CTGCTGGCAAGCATCACTCTGGG + Intronic
962458927 3:135591190-135591212 CTGGTAAACAGAATCAATCTCGG + Intergenic
963333194 3:143939340-143939362 ATGGTTATAAGCATCCTTCTTGG - Intergenic
966281229 3:178231805-178231827 CTGGTAAGAGGCATGCTTCTAGG - Intergenic
966656591 3:182365056-182365078 CTGGAAACAAGAATCAGGCTTGG + Intergenic
966864242 3:184248188-184248210 CTGGTAACCAGCATAATGCTAGG + Intronic
966890128 3:184401241-184401263 CAGCTAACAAGTGTCATTCTCGG - Intronic
968498745 4:933572-933594 TTGGTAACACACATCATTTTGGG - Intronic
969892865 4:10275876-10275898 CTGGTGACAAGCCTCATGTTGGG + Intergenic
972702454 4:41507398-41507420 CTGGTAACCAGCCTCCATCTAGG + Intronic
975209403 4:71681363-71681385 CAGGTAACATGGATCATTGTAGG + Intergenic
982673077 4:158345884-158345906 GAGGTAACAAACAACATTCTGGG - Intronic
984690367 4:182719206-182719228 CTGGTAATATGTATTATTCTTGG - Intronic
986412011 5:7490044-7490066 GTGGTAAAAATTATCATTCTTGG + Intronic
989145273 5:38243231-38243253 CTGGAAACTCCCATCATTCTTGG + Intergenic
990229732 5:53699882-53699904 CTGGTAACCAGCATTGTACTCGG - Intergenic
993982232 5:94557056-94557078 CTGGTAGGAAACATCATTTTGGG + Intronic
995943132 5:117608975-117608997 TTGGTGACATGCATGATTCTAGG - Intergenic
997827006 5:137115405-137115427 CAGGAAACCAGCATCAATCTGGG + Intronic
998678468 5:144436957-144436979 CTGGTATTAATCAACATTCTTGG + Intronic
999160620 5:149493879-149493901 CTGGTATAAAGCATTATTTTAGG - Intronic
999774540 5:154801853-154801875 CAGGTCACAAGCGTCATCCTGGG - Intronic
1000146990 5:158462999-158463021 CTAGTACAAAGCACCATTCTAGG + Intergenic
1000889065 5:166782654-166782676 CTGGTAACTAGCAGTTTTCTTGG + Intergenic
1005307157 6:24524909-24524931 CTGCAAACTAGCATCATACTGGG - Intronic
1006809988 6:36813780-36813802 GTGGTGCCATGCATCATTCTGGG - Intronic
1008028858 6:46669903-46669925 CTGGTGTCAAGCATTCTTCTAGG - Intronic
1008475600 6:51932529-51932551 CTGGTAAAAAGCAACATATTGGG + Intronic
1009753028 6:67897301-67897323 CAGGTAATAAGCATCATACCTGG + Intergenic
1011013050 6:82723530-82723552 GTGGGAATAAGCATCATTCCTGG - Intergenic
1011049049 6:83123679-83123701 CAGTTAAAAAGCATCATGCTAGG + Intronic
1011471312 6:87710470-87710492 CTGATAACAAGCATCACCTTGGG + Intergenic
1012867046 6:104631132-104631154 ATGATAAACAGCATCATTCTGGG + Intergenic
1015546161 6:134363546-134363568 CTAATAACAAGCATCATGCTGGG + Intergenic
1016326413 6:142907616-142907638 CTGTTAACAAGCCTCCTTTTGGG + Intronic
1024408395 7:49009740-49009762 CTGGTGACCATCAGCATTCTTGG - Intergenic
1028438553 7:90832237-90832259 CTGGTGCCAAGAATTATTCTAGG - Intronic
1030779896 7:113587429-113587451 CTGGAAACATGCATTTTTCTGGG + Intergenic
1036804570 8:11821054-11821076 TATGTAACAAGTATCATTCTAGG - Intronic
1043757902 8:84027355-84027377 CAAGTGGCAAGCATCATTCTAGG + Intergenic
1048359775 8:133687957-133687979 ATGGTGCCAGGCATCATTCTGGG + Intergenic
1050431472 9:5566540-5566562 ATGGTAACCAGTAACATTCTAGG + Intronic
1050822346 9:9895229-9895251 CTGGTAACAAACAGAATTCCTGG - Intronic
1052486448 9:29106508-29106530 ATAGTAACAACCCTCATTCTTGG - Intergenic
1056361604 9:85863196-85863218 GTGGTTACAGGCATAATTCTAGG - Intergenic
1056998781 9:91488400-91488422 CTTGTTGGAAGCATCATTCTAGG + Intergenic
1058730549 9:107845889-107845911 CTGGTCTCAAGCAACACTCTTGG - Intergenic
1059887457 9:118761989-118762011 CTGGAACGAAGAATCATTCTTGG - Intergenic
1197629410 X:128841213-128841235 CTATTACCAAGCACCATTCTAGG + Intergenic