ID: 1131091091

View in Genome Browser
Species Human (GRCh38)
Location 15:89625391-89625413
Sequence GTGGCGCCGGCTCCTCTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131091085_1131091091 2 Left 1131091085 15:89625366-89625388 CCCAGGAGGAAGAGGGCGGTGGG 0: 1
1: 0
2: 3
3: 42
4: 488
Right 1131091091 15:89625391-89625413 GTGGCGCCGGCTCCTCTTCCGGG 0: 1
1: 0
2: 1
3: 13
4: 173
1131091078_1131091091 23 Left 1131091078 15:89625345-89625367 CCAGACATAATTAAAGACTGGCC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1131091091 15:89625391-89625413 GTGGCGCCGGCTCCTCTTCCGGG 0: 1
1: 0
2: 1
3: 13
4: 173
1131091087_1131091091 1 Left 1131091087 15:89625367-89625389 CCAGGAGGAAGAGGGCGGTGGGC 0: 1
1: 0
2: 2
3: 33
4: 428
Right 1131091091 15:89625391-89625413 GTGGCGCCGGCTCCTCTTCCGGG 0: 1
1: 0
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131091091 Original CRISPR GTGGCGCCGGCTCCTCTTCC GGG Exonic