ID: 1131098181

View in Genome Browser
Species Human (GRCh38)
Location 15:89669204-89669226
Sequence GGGGCTTGTGGGAGACTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131098168_1131098181 13 Left 1131098168 15:89669168-89669190 CCCATAGAAAGAGGTCCACTTGG 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG 0: 1
1: 0
2: 2
3: 28
4: 318
1131098170_1131098181 12 Left 1131098170 15:89669169-89669191 CCATAGAAAGAGGTCCACTTGGG 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG 0: 1
1: 0
2: 2
3: 28
4: 318
1131098175_1131098181 -2 Left 1131098175 15:89669183-89669205 CCACTTGGGGGTATGAAGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG 0: 1
1: 0
2: 2
3: 28
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131098181 Original CRISPR GGGGCTTGTGGGAGACTCAG AGG Intronic
900011642 1:116395-116417 GGGGCTCATGGCAGAATCAGAGG - Intergenic
900333800 1:2150731-2150753 GGGGTTCCCGGGAGACTCAGAGG - Intronic
900520325 1:3102242-3102264 GGGGCTGGGAGGGGACTCAGGGG + Intronic
900685316 1:3944481-3944503 GGGGCATGTGGGAGGGACAGAGG - Intergenic
901001441 1:6150842-6150864 GGGCCGTGTGGGAAACACAGGGG + Intronic
901190761 1:7408506-7408528 GCCACTTGTGGGAGCCTCAGAGG + Intronic
902323314 1:15683556-15683578 GGGGCCTGTGGGAGTCTCTGGGG + Intergenic
902970797 1:20047056-20047078 GGGCCTTGTGGGAGTGTCTGGGG + Intronic
903331114 1:22597665-22597687 GGGGCCTGCAGGAGACTCCGGGG + Exonic
903839067 1:26225438-26225460 GGGGCTTGTGGAAGACTGGGCGG + Intergenic
904276960 1:29391079-29391101 GGGGCTGTGGGGAGACTCAGTGG + Intergenic
904545377 1:31266490-31266512 TGTGCTTGGGGGAGAATCAGAGG - Intronic
905296212 1:36956042-36956064 GGGGCCTGTGGGGGCTTCAGTGG + Intronic
912803817 1:112740256-112740278 GGGGCTTTGGGGAGGGTCAGGGG + Intergenic
915044704 1:153002359-153002381 GTGGATTGTGGGAGCCTTAGGGG + Intronic
915230432 1:154441795-154441817 GTGGCCTTTGGGAGACACAGAGG + Intronic
915836634 1:159181877-159181899 TGGGCTTGTGGTAGGCTGAGGGG - Intronic
917699626 1:177567188-177567210 GGTGCTTGAGGGAGAGTCACTGG - Intergenic
917713565 1:177711249-177711271 GTGGCCTGTGGGTGATTCAGAGG + Intergenic
918180241 1:182081042-182081064 GGGGTTTGTGGGAGACTTCATGG + Intergenic
918883073 1:190152514-190152536 GGGGGTTGGGGGAGATTCTGTGG - Intronic
918915794 1:190634875-190634897 GGGTCTTGGGTGAGACTCGGAGG - Intergenic
920299763 1:204981622-204981644 TGGGCTTTTGGGGGACTCACTGG + Intronic
920305672 1:205016688-205016710 GGGGCTTGTGGGTGGCTTGGTGG - Exonic
921101031 1:211929816-211929838 GGGACTTGTGGGTGCCTCTGAGG + Intergenic
921274415 1:213504983-213505005 GGGGGTTGTGGGGAACTTAGTGG - Intergenic
921905182 1:220488505-220488527 GCGGTTTGTGGTGGACTCAGGGG - Intergenic
922215189 1:223514595-223514617 TGGGCTTGTGTGAGAACCAGTGG - Intergenic
922419084 1:225447448-225447470 CGGTCTAGTGGGAGAGTCAGAGG + Intergenic
922608935 1:226909989-226910011 GGGGCTTGTGGGGGTTGCAGGGG - Intronic
924272343 1:242346808-242346830 AGGGCCTGTTGGAGAGTCAGGGG - Intronic
1062926233 10:1317700-1317722 TGGGCTTTTGGGGGACCCAGGGG - Intronic
1063502786 10:6570076-6570098 GGGGGTCATGGGAGACACAGAGG + Intronic
1063869596 10:10403313-10403335 GGGGCATGTGGCAGCCACAGAGG + Intergenic
1064002307 10:11673799-11673821 TTGGCCTGTGGGAAACTCAGCGG + Intergenic
1064300206 10:14116590-14116612 GGGGCTAAAAGGAGACTCAGTGG + Intronic
1064608780 10:17074960-17074982 GGGGATTATGGAAAACTCAGTGG + Intronic
1065921521 10:30397556-30397578 GAGGCTTGAGGGAGCCTCACTGG + Intergenic
1067037462 10:42930943-42930965 GGGCCATGTGGGAGACGCGGTGG - Intergenic
1067184014 10:44011867-44011889 GGAGCTTGTGGGAGCCTGGGTGG + Intergenic
1069028724 10:63572473-63572495 GGGGCCTGTTGGAGGGTCAGGGG - Intronic
1069651501 10:70053097-70053119 GGGGCTCGGGGGAGAGGCAGAGG - Intronic
1070835177 10:79443486-79443508 GGTGCTTGTGGGAGCCCCACGGG - Intronic
1071588145 10:86845628-86845650 GGGGCATGAGGGAGTCTCACTGG - Intronic
1071898174 10:90087298-90087320 GGGTCTTGTGGGAAAGTCTGGGG + Intergenic
1072211466 10:93250400-93250422 GGGGCTGTTGGGAAGCTCAGGGG - Intergenic
1072664995 10:97386088-97386110 GGGGCATGTGTGAGGTTCAGGGG - Intronic
1072720611 10:97778630-97778652 GGGGCTTGAGCGAGACTTACTGG + Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1073442030 10:103557773-103557795 GGGGCCAGCGGGAGACGCAGGGG + Intronic
1074300071 10:112225563-112225585 TGGGTTTGTGGGAGTCTGAGTGG + Intergenic
1074373881 10:112923008-112923030 GGGGATTGTGGGAGGCACTGTGG - Intergenic
1075396404 10:122130899-122130921 GGGGGTTGTGGAAAACTCTGTGG - Intronic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1076573542 10:131448998-131449020 GGGGGGTGCGGGACACTCAGGGG + Intergenic
1076763177 10:132615815-132615837 GGAGCTGGTTGGAGACTGAGGGG + Intronic
1076871275 10:133196229-133196251 GGGGCTGGTGGGATCCTCAGAGG - Intronic
1076944765 10:133638203-133638225 GGGTCGTGTCGGAGACCCAGTGG - Intergenic
1077285527 11:1763688-1763710 GGGGCTCGTGGGGGCCACAGGGG + Intronic
1077308941 11:1880068-1880090 GGGCCTAGTGGGGGACACAGAGG - Exonic
1079367729 11:19823759-19823781 GGGGCCTGTCGGGGACTCGGGGG + Intronic
1080044747 11:27797191-27797213 GGGGCTTGTGGGAGAGGCAGTGG + Intergenic
1080789718 11:35511556-35511578 GGGGCTTTTGGTGGACTCAAAGG - Intronic
1080829711 11:35880125-35880147 GTGAATTGTGGGACACTCAGGGG + Intergenic
1083223504 11:61268894-61268916 GGGGCTTGGGGCAGAGGCAGGGG + Intronic
1083544489 11:63538368-63538390 GGGGGTTGTGGGGGTCACAGAGG + Intronic
1083858183 11:65404283-65404305 GGGGTTTGAGGGAGTCGCAGAGG - Intronic
1083882823 11:65556961-65556983 GGGGCTTGGGGGAGGATGAGGGG + Intronic
1084063944 11:66692819-66692841 CGAGCTGTTGGGAGACTCAGAGG - Intronic
1084575618 11:69986242-69986264 GTGGCTTGCGGAGGACTCAGGGG + Intergenic
1084657761 11:70528959-70528981 TGGCCTTGTGGGAGCCTTAGGGG + Intronic
1085015686 11:73172772-73172794 TGGGAATGTGGGAGACCCAGAGG - Intergenic
1085725251 11:78949642-78949664 GGGGCTTGGGGAAGGATCAGAGG + Intronic
1087023257 11:93624273-93624295 GGAGCTTGTGGGAGAATTAATGG - Intergenic
1087136461 11:94725626-94725648 GGAGCCTGTGGGAGCCTCTGAGG + Intronic
1088005535 11:104934707-104934729 GGGGCTTGTGAGGGGCTCAGGGG + Intergenic
1088899407 11:114103832-114103854 GGGGCTTGTGGTGGCATCAGTGG + Intronic
1089383273 11:118051295-118051317 CTGGCTTGTGGGAGACCCAGGGG - Intergenic
1089896433 11:121934983-121935005 GTAGCTGGTGGGAGAATCAGAGG - Intergenic
1090369068 11:126234621-126234643 TGGGTTTGCGGAAGACTCAGGGG - Intronic
1090597670 11:128336565-128336587 GGAGCTTGGGGGAGAGTCAATGG - Intergenic
1091633243 12:2177960-2177982 TAGGCTTGTGGGAATCTCAGAGG - Intronic
1095839762 12:46680321-46680343 TGGGGCTGTGGGAGCCTCAGAGG + Intergenic
1096252236 12:50040664-50040686 AGGCATTGTGGGAGAATCAGAGG - Intergenic
1096455001 12:51777541-51777563 GGGGCTTAACAGAGACTCAGAGG + Intronic
1099221720 12:79922674-79922696 GGGGCCTGTCGGGGGCTCAGGGG + Intronic
1100522736 12:95390925-95390947 GGGCCTTGTGGGAGTGTCTGGGG + Intergenic
1101991127 12:109486087-109486109 AGAGCTTGTGGGAGACACTGCGG - Intronic
1102775552 12:115515679-115515701 GGGGATGGTGAGCGACTCAGAGG + Intergenic
1103954597 12:124569005-124569027 GGGGCTGGCGGGAGCCTCTGGGG + Intergenic
1106101032 13:26695280-26695302 GGTCCTTGTGGCAGACACAGGGG + Intergenic
1106249153 13:27970994-27971016 GGGGGTGGTGGGGTACTCAGGGG + Exonic
1111831785 13:93339436-93339458 GGAGCTTCTGAGATACTCAGGGG - Intronic
1111916285 13:94364220-94364242 GCAGCTTGTAGGAGACTAAGAGG + Intronic
1112053807 13:95671368-95671390 GGGCCTTGGGTGAGACTCTGAGG - Intergenic
1112611232 13:100956866-100956888 GGGGCATGGGAGAGAATCAGGGG - Intergenic
1113280145 13:108779713-108779735 CTGGCGTGTGGGAGACCCAGGGG - Intronic
1113745509 13:112741634-112741656 TGGGCTGCAGGGAGACTCAGGGG + Intronic
1113922135 13:113919197-113919219 GGGGCCTCTGGTTGACTCAGAGG - Intergenic
1114363024 14:21996987-21997009 GGAGCCAGTGGGATACTCAGAGG + Intergenic
1115130241 14:30046067-30046089 GGGAATTCTGGGAGACCCAGGGG - Intronic
1116087228 14:40255547-40255569 GGTGCTTGTGGGAGTTTCACTGG - Intergenic
1117300406 14:54420567-54420589 GGGGCGAGTGGAAGACTCACAGG - Intergenic
1118808352 14:69256707-69256729 GGGGCATCTGGGAGCCCCAGGGG + Intergenic
1119405934 14:74399699-74399721 GGGGGTTGGGGGTGACCCAGGGG + Intergenic
1120275706 14:82370290-82370312 GGGGCTTAGGTGAGACTCTGAGG + Intergenic
1120974884 14:90239800-90239822 GGGCCTTGTGGGAGTGTCTGGGG + Intergenic
1121211438 14:92210600-92210622 GGGGCTTGTGTCTCACTCAGAGG - Intergenic
1122635895 14:103129510-103129532 GGGGGTGGTGAGAGAGTCAGAGG + Intronic
1122694416 14:103545841-103545863 AGGGCTTCGGGGGGACTCAGCGG - Intergenic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1124705689 15:31962049-31962071 GGGCCTAGTGGGGGACTCATGGG + Intergenic
1124844663 15:33278977-33278999 GAGGGTTGTGGATGACTCAGTGG - Intergenic
1125732165 15:41899081-41899103 GTGCCTTTTGGAAGACTCAGTGG + Exonic
1126486495 15:49187444-49187466 GGGCCTTGAGGGAGCATCAGTGG - Intronic
1129209401 15:74058795-74058817 GAGGCTTGAGGGAGCCTCACTGG + Intergenic
1129477814 15:75797932-75797954 GAGGCTTGAGGGAGCCTCATTGG - Intergenic
1129667951 15:77590043-77590065 TGGGCTTGTGCCAGACTCTGAGG + Intergenic
1129739354 15:77982583-77982605 GGGGCGGGGGGGAGACTGAGAGG - Intergenic
1129835876 15:78705204-78705226 GAGGCTTGAGGGAGCCTCACTGG - Intronic
1129846602 15:78770648-78770670 GGGGTATGGGGGAGACTGAGAGG + Intronic
1130511470 15:84593421-84593443 GAGGCTTGAGGGAGCCTCACTGG + Intergenic
1130894623 15:88160412-88160434 GAGGCTTGGGGCAGAGTCAGCGG + Intronic
1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG + Intronic
1131381156 15:91965081-91965103 GGGGCTGTGGGGATACTCAGTGG + Intronic
1132114149 15:99123709-99123731 GGGGCCTGTGGGTGATTCACGGG - Intronic
1133027664 16:2995700-2995722 GGGGCTGGTGAGTGACTCAGGGG - Intergenic
1133079644 16:3308478-3308500 GGGCTTTGTGGGAGACCAAGGGG + Intronic
1133604142 16:7369381-7369403 AGGGCTTGAGGGAGAGTCTGCGG - Intronic
1133891502 16:9883587-9883609 AGGGCTTGGGGGACACTCCGGGG + Intronic
1134098653 16:11436224-11436246 GGGGCTGGTGGGGGAAGCAGAGG + Intronic
1135601154 16:23784716-23784738 GGTGCAGGTGGGAGGCTCAGAGG + Intergenic
1137019978 16:35415056-35415078 GGGTCGTGTTGGAGACCCAGTGG - Intergenic
1138510817 16:57507620-57507642 GGGGCTTGAGGAAGACTGGGAGG + Intergenic
1139530974 16:67542630-67542652 GGGGCTTGTGGAAGTATGAGTGG - Exonic
1140333027 16:74076169-74076191 GGGGCCTGTGGGGGAGGCAGGGG + Intergenic
1140839464 16:78825684-78825706 GTGGTTTCTGGGAGACTCTGAGG + Intronic
1141732745 16:85833777-85833799 GGGGCTTGTGGGAGAGGAATGGG + Intergenic
1141924072 16:87155677-87155699 GGGGCCTGTCGGGGAGTCAGGGG + Intronic
1141979430 16:87540914-87540936 GGGGACTGAGGGAGGCTCAGGGG - Intergenic
1142104915 16:88297500-88297522 GTGGGCTGTGAGAGACTCAGCGG - Intergenic
1142179967 16:88663592-88663614 GCGCCGTGTGGGAGACTCTGCGG + Intergenic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142412868 16:89924969-89924991 GGGGCTCCTGGGAGGGTCAGGGG + Intronic
1143739472 17:8941997-8942019 GGGGCTTCAGGGAGGCTCAGGGG + Intronic
1144182097 17:12761983-12762005 GGGGAGTGTGGAAGATTCAGGGG + Intronic
1144624539 17:16838027-16838049 GGGGGTTGTGGGAGAAAGAGTGG + Intergenic
1144657323 17:17045088-17045110 GGGGCTTGGGGGAGACTGATGGG - Intronic
1144742373 17:17591236-17591258 TGAGATTGTGTGAGACTCAGAGG - Intronic
1144818478 17:18053712-18053734 GTGGCTTGAGGGAGCCTTAGTGG + Intronic
1144843588 17:18203951-18203973 GGGGCTTTTGGGGCACACAGGGG + Intronic
1146028352 17:29342697-29342719 GAGGTGTGTGGGAGACTTAGGGG + Intergenic
1146163281 17:30571146-30571168 GGGGCATGTGGGCCACACAGGGG + Intergenic
1146441866 17:32904133-32904155 GGGCCTTGTGGGAGTGTCTGGGG - Intergenic
1146530754 17:33605892-33605914 GAGGCTTGCCCGAGACTCAGTGG - Intronic
1147578670 17:41616748-41616770 GGGGGTTGTGGGAGAAAGAGTGG + Intergenic
1147747821 17:42706234-42706256 GGGGCTTGTGGTTGACTCAAGGG + Intronic
1148201666 17:45753619-45753641 GGGGCCTGTGGGAGGTTCTGAGG - Intergenic
1148350064 17:46934905-46934927 GGGGCTGGTGAAAGAATCAGCGG - Intronic
1149238383 17:54619009-54619031 GGGACTAGTGGGAGACCCAATGG + Intergenic
1149623315 17:58062043-58062065 GGGCCTTGGGGGCCACTCAGAGG + Intergenic
1151326943 17:73385429-73385451 GGGGCTTCATGGAGACTCTGGGG + Intronic
1152152641 17:78612183-78612205 TGGGAGTTTGGGAGACTCAGAGG - Intergenic
1152157179 17:78642100-78642122 GGGGCTTGTGAGAGTCACAGAGG + Intergenic
1152260099 17:79262236-79262258 TGGGCTTGTGGGAGCCTCCATGG - Intronic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1152432062 17:80253995-80254017 GAGGCCTGTGGCAGCCTCAGAGG + Intergenic
1152629814 17:81405864-81405886 GGGGGTTGGGGGAGACTCTCCGG - Intronic
1152846191 17:82601132-82601154 GGGTCTTGTGGGAGCCTCCGCGG + Intronic
1152892307 17:82889400-82889422 GGTGCTGCTGGGAGGCTCAGTGG + Intronic
1156520765 18:37720828-37720850 GGGCCAAGGGGGAGACTCAGGGG - Intergenic
1156901521 18:42305876-42305898 GGGTCTTGTGGGAGTCTCTATGG + Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1158632843 18:59131433-59131455 GTGGCCTGTGGGACACCCAGGGG - Intergenic
1158903057 18:61984230-61984252 GGGGCCTTTGGGAGATTCTGAGG - Intergenic
1161723634 19:5916614-5916636 GGGGCTTCTGTGAGAGGCAGAGG - Exonic
1161741208 19:6022127-6022149 AGGGGTTGTGGGAGGCGCAGGGG + Intronic
1162024874 19:7888318-7888340 GGGGCTGGCGGGAGATGCAGGGG - Intergenic
1162029528 19:7911369-7911391 AGGGCTTCTGGGGGACTCGGAGG + Intronic
1162911314 19:13849288-13849310 GGGTCCTGTGGGCGGCTCAGTGG + Intergenic
1165213786 19:34254873-34254895 GGGGCGCGTCGGAGACTCGGCGG + Intronic
1165758865 19:38309169-38309191 TGGGCCTGTGGGGGGCTCAGGGG - Intronic
1166524981 19:43504958-43504980 GGGGCTCGAGGGAGACTGGGAGG - Intergenic
1166543435 19:43620335-43620357 GGGGGCTGTGGGAGCCTAAGAGG + Intergenic
1166824172 19:45599081-45599103 GGGGCCTGTGGGACAGACAGGGG - Intronic
1166837587 19:45677050-45677072 GGTGCTCGTGGGAGGCTCCGAGG + Exonic
1167404176 19:49293459-49293481 AGGGCTGGTGGCAGACCCAGTGG + Intronic
1167614666 19:50525843-50525865 GGGCCTGGTGGGAGAGGCAGAGG - Intronic
1167707682 19:51091262-51091284 GGGGCTGGTGGGAGAATTAAGGG - Intergenic
1167795139 19:51703967-51703989 GGGGCTTGTAGGTTACTCAGTGG + Intergenic
1168263770 19:55209916-55209938 GGGGCTTGTGGGAGACGGAGAGG - Intergenic
925221783 2:2147655-2147677 GGGGCGGGTGGGTGGCTCAGAGG + Intronic
928863979 2:35895641-35895663 AGGCCTTGGGTGAGACTCAGAGG - Intergenic
931281219 2:60793664-60793686 TGGGCTGGTGGTACACTCAGTGG - Exonic
932839199 2:75065627-75065649 GGGGGTTGTGGGAGACGGATTGG + Intronic
934476853 2:94599338-94599360 GGGGCTTCTGAGGGACCCAGTGG + Intronic
934668688 2:96192969-96192991 GAAGCCTGTGGGAGACTCATAGG + Intronic
935216298 2:100977692-100977714 GGGGCCTGTGGGAGAGAAAGGGG - Exonic
936239189 2:110772460-110772482 AGGGCTTGTGGGTGGCTCATAGG + Intronic
939653764 2:144796649-144796671 GGAGCTTGAGGCAGAATCAGGGG + Intergenic
941779896 2:169432531-169432553 GGGGCTGGTGGGAGTCTCATAGG - Intergenic
942420575 2:175802879-175802901 GGGGGTTGAGGGAAACTCCGAGG + Intergenic
943090609 2:183370128-183370150 GCAGCTTGTGGGAGGCCCAGAGG + Intergenic
943314115 2:186364634-186364656 GGGGGTGGTGGGGGACCCAGTGG - Intergenic
943529370 2:189059964-189059986 GGGGCTGCAGGGTGACTCAGGGG - Intronic
943846563 2:192656216-192656238 GGGGCAGGTGGGAGACTCTCTGG + Intergenic
944763407 2:202840484-202840506 GGGGCTTGTGAGACCCTCATAGG + Intronic
944955061 2:204798898-204798920 GGGCCTTGGTTGAGACTCAGAGG + Intronic
946282017 2:218672444-218672466 GGAACTTGGGGGAGACTCAAAGG + Intronic
948713010 2:239836832-239836854 GGGGCTTTTAAGAGCCTCAGAGG - Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1169092894 20:2872342-2872364 GGTGCGTGAGGGGGACTCAGGGG + Intronic
1170634757 20:18094405-18094427 GAGGCATGAGGGAGACTCAGAGG + Intergenic
1171782097 20:29428198-29428220 GGGTCATGTCGGAGACCCAGTGG - Intergenic
1171887679 20:30671214-30671236 GGGGCTGGTGGGAGATTCTCTGG - Intergenic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1174465093 20:50711179-50711201 GGGGCTTGAGGGAGTGGCAGAGG + Intergenic
1175898944 20:62352452-62352474 TTGGCCTGTGGGAGCCTCAGTGG - Intronic
1175927912 20:62480062-62480084 GGGGCTTCTGGGGGCCTGAGTGG + Intergenic
1175970448 20:62684188-62684210 GGGGCATGTGGCAGCCCCAGGGG + Intronic
1179504320 21:41830869-41830891 GGTGCCTGTGTGAGAGTCAGAGG - Intronic
1180059337 21:45376552-45376574 GGGGCTTGTCAGAGTCACAGGGG - Intergenic
1181039262 22:20184262-20184284 GGGGCTTGTGGGGTACATAGGGG - Intergenic
1181306749 22:21921423-21921445 GGGGCTAGGGGAGGACTCAGAGG - Exonic
1181417664 22:22772044-22772066 GAGGCTTGTGAGAGCCTGAGGGG + Intronic
1182712708 22:32332548-32332570 GGGCCTTCTGGGAGTCTCTGAGG + Intergenic
1183787535 22:40038838-40038860 GGGGCTGTTGTGAGACTCACGGG - Exonic
1184177364 22:42795877-42795899 GGGGCTGGGGGGAGACTGAGGGG + Intergenic
1184236248 22:43184672-43184694 AGGGCTGGGGGGAGGCTCAGAGG + Intronic
1184780417 22:46646298-46646320 GGAGCTTCTGGGAGCATCAGGGG - Intronic
1185323180 22:50211383-50211405 GGGTCGTGTGGGTGACTCACTGG + Intronic
951495067 3:23316728-23316750 GGGCCTTGAGCGAGACTCTGAGG - Intronic
952873872 3:37925457-37925479 GGGGCTTGTTGGAGGCTGTGGGG + Intronic
953032243 3:39186478-39186500 GGGGCATCTGAGAGCCTCAGGGG - Exonic
953473703 3:43188213-43188235 AGGGTTTGTGGGAGACACAGAGG + Intergenic
953878801 3:46681130-46681152 GGGGCTTAAGAGAGACACAGTGG + Intronic
954563345 3:51577767-51577789 GGGGCTTGTCGGACACTGGGTGG - Intronic
955274390 3:57533478-57533500 GGGCCTTGAGTGAGACTCTGAGG - Intronic
956698921 3:71941873-71941895 TTGACTTGTGTGAGACTCAGTGG + Intergenic
957624431 3:82640869-82640891 GGGGCTTTTATGAGCCTCAGAGG - Intergenic
957699134 3:83686864-83686886 GGGCCTTGGGTGAGACCCAGAGG - Intergenic
959991723 3:112638717-112638739 GGGGCCTGTGGGAGGGTGAGGGG + Exonic
960595526 3:119404446-119404468 GGGGCTGCTGAGAGGCTCAGGGG + Intronic
961322563 3:126085804-126085826 GGGCCTTGTGGGAGTGTCTGGGG + Intronic
964712668 3:159687752-159687774 GGGGCTTGTCGGAGAGTGAGGGG - Intronic
965087229 3:164114105-164114127 AGGGCTTTTGTGAGCCTCAGAGG - Intergenic
966944150 3:184765890-184765912 GTGGCTGGTGGCAGGCTCAGAGG + Intergenic
967241232 3:187441483-187441505 GGTGCTTTTGGGAGAAGCAGAGG + Intergenic
967886413 3:194336670-194336692 GCGGCTAGAGGGAGGCTCAGAGG - Intergenic
967999859 3:195197831-195197853 GGGGAATGTGTGAGACTAAGTGG - Intronic
969064239 4:4465597-4465619 GGGGCCTGTTGGAGGATCAGGGG + Intronic
969302380 4:6304682-6304704 GGGGTTTGTGGCAGAATGAGTGG - Intergenic
969952561 4:10853543-10853565 GGGGGTGGTTGGAGACCCAGTGG + Intergenic
971417943 4:26450795-26450817 GGGGCCTGTCGGAGGGTCAGAGG + Intergenic
972703031 4:41512742-41512764 GGGGGTTGTGGGTGAGTAAGAGG + Intronic
973815401 4:54614631-54614653 GGGGCTTGTGAGAGAGGGAGAGG + Intergenic
979415934 4:120438942-120438964 GGTGTTTATGGGAGACTGAGGGG - Intergenic
979616674 4:122750495-122750517 GGGGTTGGTGGTAGACCCAGTGG + Intergenic
980179665 4:129388473-129388495 GGGATTTGTGGGAAACACAGAGG + Intergenic
985448150 4:190038712-190038734 GGGTCGTGTCGGAGACCCAGTGG - Intergenic
985819534 5:2150179-2150201 GAGGCTGATGGGAGAATCAGAGG + Intergenic
987987047 5:25161323-25161345 GGGCCTCGTGGGAGTCTCTGGGG - Intergenic
992950267 5:81851375-81851397 GGGGATGGCGGGAGACTTAGTGG - Intergenic
997791887 5:136769249-136769271 GGTGGTGGTGGGAGGCTCAGAGG + Intergenic
998442787 5:142176135-142176157 GAGGCTTGTGCGGGAGTCAGAGG - Intergenic
998483248 5:142480233-142480255 GGGGGTTGTGGTAGGCTCAGAGG + Intergenic
1001516214 5:172356888-172356910 GGGGCTTGGATTAGACTCAGAGG - Intronic
1001595548 5:172896525-172896547 GGGGCCTGTGGCAAACTCATGGG + Intronic
1007348119 6:41248418-41248440 TGGTTTTGTGGGAGACTCTGGGG + Intergenic
1007789699 6:44301965-44301987 GGGGCATGGGGGTGAGTCAGAGG - Intronic
1009610147 6:65930952-65930974 GGGGCTTTTATGAGCCTCAGAGG + Intergenic
1011412362 6:87079164-87079186 GGAGCTTCTGGAAGAGTCAGTGG - Intergenic
1011474478 6:87737454-87737476 GGGGCAGGTGGGAGAGTGAGGGG - Intergenic
1012483078 6:99689749-99689771 GGGCCTTGGGTGAGACTCAGAGG + Intergenic
1013175767 6:107675324-107675346 GGGGCCTGTGTGACCCTCAGTGG - Intergenic
1017685658 6:156911730-156911752 AAGGCTTGTGAGAGAGTCAGAGG + Intronic
1018351241 6:162961584-162961606 GTGGAGTGTGGTAGACTCAGAGG - Intronic
1018680178 6:166258088-166258110 GGGGCGTGTGGCAGACTCCCAGG - Intergenic
1019476005 7:1244608-1244630 GGGGCTGATGGGTGGCTCAGTGG + Intergenic
1019514587 7:1434157-1434179 TGGGCTGGTGGGAGCCTCAGAGG - Intronic
1019556285 7:1633187-1633209 GTGGCTGCTGGGAGACCCAGGGG + Intergenic
1022638500 7:32159895-32159917 GGAGCTTGTGGGAGCCTCTGGGG - Intronic
1022908746 7:34880009-34880031 GGCTCTTGAGGGAGACTCACAGG + Intergenic
1023772270 7:43568672-43568694 GGGTCTTGTGCCAGACACAGGGG + Intergenic
1024714316 7:52057749-52057771 GGGGCTTGTTGGGGAGTCGGGGG - Intergenic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1027674695 7:81143196-81143218 GGGCCTTGGGTGAGACTCAGAGG + Intergenic
1028459719 7:91077480-91077502 GGGGCCTGTTGGGGAGTCAGGGG + Intronic
1028802010 7:94977102-94977124 GGGGCTTGTGGGAGTAAGAGGGG + Intronic
1029008359 7:97232976-97232998 GGGGCTTCTGGGAAAATCATGGG + Intergenic
1029215347 7:98944566-98944588 GGGGCTTGTCTGAAACTCAGAGG + Intronic
1029670872 7:102029867-102029889 GCGGCTTTTGGGAGACCCACTGG + Intronic
1030173270 7:106626186-106626208 GTGGCTTGTGGAAAACTGAGAGG + Intergenic
1032266776 7:130375069-130375091 GGGCATTGTGGGAGGCTGAGAGG - Intergenic
1034238690 7:149592780-149592802 GGGTCTTCTGGAAGAATCAGGGG + Intergenic
1034400256 7:150857310-150857332 GGGGCTTGTGGGAGGAGAAGAGG - Exonic
1034400608 7:150859064-150859086 GGGGCCTGGGGGAGGGTCAGTGG + Intronic
1034547101 7:151796312-151796334 GGGGCCTGTGGGTGTCTCACTGG - Intronic
1035053840 7:156020400-156020422 GGGGCTTGTGGGACTGTCTGGGG + Intergenic
1036335348 8:7865986-7866008 GGGGCTTGGAGGAGTTTCAGTGG - Intronic
1037891308 8:22625115-22625137 GGACCGCGTGGGAGACTCAGAGG + Intronic
1038575553 8:28701313-28701335 GGGGATTGTGGGAGGCGCGGGGG - Exonic
1039894170 8:41704636-41704658 GATGCTTGTGGGAGACCCAAGGG + Intronic
1040311250 8:46237971-46237993 GGGGCTTCTGGGAGAGACACAGG - Intergenic
1040334789 8:46410565-46410587 GGGCCTTCTGGGAGAGACAGAGG - Intergenic
1040422028 8:47249924-47249946 GGGGCTTGTGGGACACTGTTAGG - Intergenic
1045064224 8:98431302-98431324 GAGGCTTGTGGGAGGCTGGGAGG + Exonic
1046542144 8:115599492-115599514 TGGGCTTGTTGGAGAGTCGGGGG - Intronic
1046583241 8:116119619-116119641 GGGGCTTGGGGAAGAGGCAGAGG - Intergenic
1047299651 8:123602188-123602210 GGGGCTATTGGGAAAGTCAGGGG - Intergenic
1048800040 8:138186823-138186845 GGTTCTAGTGGGAGATTCAGGGG - Intronic
1049429262 8:142551600-142551622 GTGGCTTTGGAGAGACTCAGAGG - Intergenic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1049556085 8:143282961-143282983 GGGGCTTGTAGCAGCCGCAGGGG - Intergenic
1049575707 8:143388768-143388790 GTGGCTGGAGGGGGACTCAGGGG + Intergenic
1049708528 8:144053562-144053584 GGGCCTTGTGGCTGCCTCAGAGG - Intronic
1052334658 9:27307247-27307269 GGTGCTTGTGAGAGACTTAGGGG - Intergenic
1052386706 9:27831263-27831285 GGGGCCTGTGGGAGTGGCAGGGG - Intergenic
1052853175 9:33390571-33390593 GGGGCTTCTGAGGGACCCAGTGG - Intronic
1053681213 9:40486739-40486761 GGGGCTTCTGAGGGACCCAGTGG - Intergenic
1053931200 9:43115071-43115093 GGGGCTTCTGAGGGACCCAGTGG - Intergenic
1054282501 9:63138195-63138217 GGGGCTTCTGAGGGACCCAGTGG + Intergenic
1054294300 9:63322255-63322277 GGGGCTTCTGAGGGACCCAGTGG - Intergenic
1054392322 9:64626743-64626765 GGGGCTTCTGAGGGACCCAGTGG - Intergenic
1054426970 9:65131953-65131975 GGGGCTTCTGAGGGACCCAGTGG - Intergenic
1054503405 9:65889587-65889609 GGGGCTTCTGAGGGACCCAGTGG + Intronic
1055672066 9:78617816-78617838 GTAGCCTGTGGGAGATTCAGAGG + Intergenic
1056763905 9:89433228-89433250 GGGACTCGTGGCAGCCTCAGGGG - Intronic
1056774640 9:89501966-89501988 GGGTCCTGTGGGGGTCTCAGTGG - Intergenic
1057034052 9:91799035-91799057 GGGGCATGTGTGAGACAGAGTGG - Intronic
1057619110 9:96619435-96619457 GGGGCTGGCGGGAGCCTCGGCGG - Exonic
1058199556 9:102022359-102022381 GGGGCCTGTTGGAGGGTCAGGGG - Intergenic
1059395366 9:114031142-114031164 AGGGCTTTTGGGAGAATTAGAGG + Intronic
1060816343 9:126637481-126637503 GGGGGTTGTGGGTGATTCTGTGG + Intronic
1061135451 9:128730794-128730816 AAGGCTTTTGGGAGACCCAGTGG + Exonic
1061217016 9:129227414-129227436 GGGTCCTTTGGGGGACTCAGAGG + Intergenic
1061997195 9:134192566-134192588 TGGGCTGGTGGGGGACACAGCGG + Intergenic
1203441890 Un_GL000219v1:16419-16441 GGGTCGTGTCGGAGACCCAGTGG - Intergenic
1203512698 Un_KI270741v1:135328-135350 GGGTCGTGTCGGAGACCCAGTGG - Intergenic
1185745720 X:2572038-2572060 GGGGCTTTTGGGGGCCTCAGGGG - Intergenic
1187126911 X:16462502-16462524 TGGGCATGTGGGATACCCAGTGG - Intergenic
1193858958 X:86640378-86640400 GGGGCATGGGGGAGACTGACTGG - Intronic
1195546875 X:106122984-106123006 GGGCCTTGTGGGAGTGTCTGGGG - Intergenic
1197681865 X:129393897-129393919 GGGCCTTGGGGTAGACTCTGAGG - Intergenic
1197749344 X:129953981-129954003 GTGGCGAGGGGGAGACTCAGGGG - Intergenic
1199005715 X:142693749-142693771 GGATCCTGGGGGAGACTCAGAGG + Intergenic
1199415080 X:147573183-147573205 GGGGTTTGGGGGATAATCAGTGG - Intergenic
1200065985 X:153504278-153504300 CAGGCTTCTGGCAGACTCAGAGG + Intronic
1201062306 Y:10058615-10058637 GGGGCATGGGGGTGTCTCAGTGG + Intergenic