ID: 1131098540

View in Genome Browser
Species Human (GRCh38)
Location 15:89670924-89670946
Sequence TATCTACCCTTCCCACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131098540_1131098542 0 Left 1131098540 15:89670924-89670946 CCTGTTTGTGGGAAGGGTAGATA 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1131098542 15:89670947-89670969 GTTGGTCAGTGAGATAGATGAGG 0: 1
1: 0
2: 2
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131098540 Original CRISPR TATCTACCCTTCCCACAAAC AGG (reversed) Intronic
904294778 1:29512758-29512780 TTTCTATACTTCCCTCAAACTGG + Intergenic
905300473 1:36983224-36983246 AACACACCCTTCCCACAAACCGG + Intronic
905576962 1:39052545-39052567 TTTCTACCTTTCACTCAAACTGG + Intergenic
905785984 1:40758035-40758057 TTTCCACTCTTCCCCCAAACAGG - Intronic
910183128 1:84506551-84506573 CCTCAACCCTTCCCACAAACTGG - Exonic
910550198 1:88466784-88466806 TATTTACCCTTCCCTCTAACTGG + Intergenic
912668370 1:111603328-111603350 TCATTACCCTTCCCACATACTGG - Intronic
912942548 1:114058073-114058095 TATCTTCCCTTCCTACAGTCAGG - Intergenic
914831775 1:151175529-151175551 TTACTACCCTTCCCCCAACCTGG - Intronic
916187843 1:162150131-162150153 CAACTACCCTTCCCACCTACTGG + Intronic
916361389 1:163973699-163973721 TATCTACAATTCTCAAAAACAGG + Intergenic
919143158 1:193599205-193599227 TATGTACTCTTCCCAGAAATTGG - Intergenic
920915378 1:210254166-210254188 TATCTACCCTTCTCACAGCAGGG + Intergenic
921063186 1:211603556-211603578 TGTGTACCATACCCACAAACTGG - Intergenic
922153004 1:223021169-223021191 TGTCCACCTTTCCCAGAAACTGG + Intergenic
1063647596 10:7900717-7900739 TATGTAACCTCCCCCCAAACTGG - Intronic
1067454778 10:46411630-46411652 TATATACCCTCCCCACAACCAGG + Intergenic
1067632426 10:47973004-47973026 TATATACCCTCCCCACAACCAGG - Intergenic
1067765652 10:49084001-49084023 GATCTACCCTTGCCACAGCCAGG + Intronic
1068862468 10:61861300-61861322 CATTTAATCTTCCCACAAACTGG + Intergenic
1077656061 11:4019949-4019971 TGTCTACCCTTCCCAGATTCTGG + Intronic
1083625785 11:64071421-64071443 TGTCTACCCTTCCCCTTAACTGG + Intronic
1085572068 11:77568530-77568552 TCCCTCCCCTTTCCACAAACAGG + Intronic
1087453018 11:98348733-98348755 TAGATACCTTTCCCACAAAGAGG - Intergenic
1089880811 11:121771774-121771796 TAGCTACCCTTCCCAAGAGCAGG - Intergenic
1096171268 12:49472534-49472556 CAACTCCCCTTCCCAGAAACTGG + Intronic
1098656007 12:73030234-73030256 TTTCAACCCTTTCCACAAAAAGG + Intergenic
1098696813 12:73569547-73569569 TATCTACCATTTCTACAATCAGG + Intergenic
1106255689 13:28020233-28020255 CATCTCCCCTTCCCCCAACCAGG + Intronic
1106340631 13:28823466-28823488 TCTTGACCCTTCCCACCAACGGG + Intronic
1109305555 13:60637048-60637070 AATATAACCTTCCCACCAACAGG - Intergenic
1109937097 13:69301273-69301295 TATTTACCTTTCCCACTAGCTGG - Intergenic
1112289597 13:98133614-98133636 TATCTGCCCTACCTCCAAACAGG - Intergenic
1112485047 13:99812138-99812160 TATCTCCCCTCCCCAAAACCTGG - Intronic
1112494106 13:99892368-99892390 TATTTACCCTTACTACAAGCTGG - Exonic
1113504188 13:110801956-110801978 TTTCTACCCCTCCCACGAGCTGG + Intergenic
1113570675 13:111354388-111354410 TTTCTACACTTCCCTCACACAGG + Intergenic
1114460282 14:22882295-22882317 TATCTGGGCTTCCTACAAACAGG + Intergenic
1115792109 14:36891776-36891798 GATTTCCCCTTCCCACTAACTGG + Intronic
1119547219 14:75480565-75480587 TTTCTACCCCTCCCACACACAGG + Intergenic
1120856476 14:89216965-89216987 TATCTGCCCTTCCCCCAGCCTGG + Intronic
1122701221 14:103590414-103590436 GACCTACCCTGCCCCCAAACAGG - Exonic
1125756574 15:42069463-42069485 TATCTTCTCTTCTCACCAACTGG - Intronic
1127198560 15:56617410-56617432 TATTTACCCTTTTCCCAAACAGG - Intergenic
1128999978 15:72324361-72324383 TTTCTACACTTCACTCAAACTGG - Intronic
1131098540 15:89670924-89670946 TATCTACCCTTCCCACAAACAGG - Intronic
1131320652 15:91386930-91386952 TATCTACCCTTCCCAAACTCTGG + Intergenic
1135213386 16:20543154-20543176 CATCTGCCCGTCCCATAAACTGG + Exonic
1135259234 16:20966566-20966588 CATCTACCTTTCCCTCAAAGCGG + Intronic
1139314688 16:66058162-66058184 TATCCACCCCTTCCCCAAACTGG - Intergenic
1145831536 17:27920455-27920477 TTTCTATCCTCCCCAGAAACGGG + Intergenic
1147686403 17:42289005-42289027 TATCTCCCCTTCCCAGAAACCGG + Intronic
1149706502 17:58699608-58699630 TGTCTGCCCTTCCTAAAAACAGG + Intronic
1150624987 17:66835746-66835768 TATCAACCCTTCTCACAGGCGGG - Intronic
1152828772 17:82484335-82484357 TATCTTACCTTCCCCCAAAAGGG - Intronic
1158379621 18:56914583-56914605 TATATCCCCTTCCCAAAAGCGGG - Intronic
1159286843 18:66364620-66364642 TTTCTACCCTTCACTCAAACTGG + Intergenic
1159772138 18:72558651-72558673 TGTCGACCCTTTCCTCAAACAGG - Intronic
1160124251 18:76155818-76155840 CATCTACCCTTCCAACACCCTGG + Intergenic
1161875628 19:6906783-6906805 CTTCTCCCCTTCCCACAAGCTGG - Intronic
1164746263 19:30616883-30616905 TAACTACCCTTTTCACAAAAAGG + Intronic
928636298 2:33250548-33250570 CATCTACCCTTTCCTCACACTGG - Intronic
930069788 2:47356927-47356949 TATATCCCCTTCGCACTAACTGG + Intronic
930429078 2:51251217-51251239 CATCTACCCTTTCCCCACACTGG - Intergenic
930430449 2:51268712-51268734 AATCTAACCTTACCAAAAACTGG - Intergenic
932226634 2:70046432-70046454 TTTCTAGGCTTCCCACATACAGG + Intergenic
933131693 2:78681020-78681042 TATCTCCCCTTCTCACATTCTGG - Intergenic
938126272 2:128673948-128673970 TTTTTACACTTCCCTCAAACTGG + Intergenic
938223126 2:129588870-129588892 TATCTAAACTTCACTCAAACTGG + Intergenic
938506895 2:131894531-131894553 TATCTACCTTCTCTACAAACAGG - Intergenic
938709315 2:133962227-133962249 TATCTACTCTTCCTACCAAGAGG + Intergenic
940011586 2:149060421-149060443 TATGTCCCCTTCCCAGAAAAGGG - Intronic
941685915 2:168448587-168448609 TATTTACTCTTCCCATAAATTGG + Intergenic
941982236 2:171471255-171471277 TATCTACTCTTCTGACTAACAGG - Intronic
946346721 2:219117015-219117037 TCTCTTCCCATCCCACAACCTGG + Intronic
1176786740 21:13265757-13265779 TATCTACCTTCTCTACAAACAGG + Intergenic
1176905957 21:14501903-14501925 TTTCTACCCTTGCCAATAACTGG - Intronic
1177476500 21:21630806-21630828 TATCAACACTTCCCACCACCGGG - Intergenic
1177985349 21:27967844-27967866 TATCTACCTTCTCTACAAACAGG + Intergenic
1182136105 22:27904803-27904825 TTTATTCCCTTCCCACAAACTGG - Intronic
1184142423 22:42585672-42585694 TGGCAACCCTTCCCACAATCAGG + Exonic
951319735 3:21229851-21229873 CACCTACCCTTCCCACACACAGG + Intergenic
951399766 3:22217170-22217192 AATATACTCTTCCCACAAATTGG + Intronic
952505511 3:34003874-34003896 CCTCTACCTTTCCCACAAATAGG - Intergenic
952740065 3:36726189-36726211 TATTTAACCTTCCCTCAAACTGG - Intronic
952815253 3:37442023-37442045 TAATTCCCCTTCCCTCAAACAGG - Intergenic
952846640 3:37693481-37693503 TATCTACCTTTACCACAGAAAGG + Intronic
953179731 3:40584221-40584243 TATCTTCCCATCCCTCAAGCTGG - Intergenic
954349464 3:50030898-50030920 TAACTACCCTTCCCATACTCTGG - Intronic
955906253 3:63810829-63810851 TATCAACCCATCCACCAAACTGG + Intergenic
958504841 3:94961970-94961992 TTTCTACCCTCCCAAGAAACTGG + Intergenic
959357341 3:105349103-105349125 TCTCTCCCCTTCCCACACTCTGG + Intergenic
960916122 3:122696629-122696651 TATCAACTCTCACCACAAACTGG - Intronic
963084763 3:141426588-141426610 CATCTTCCCTTCCCACACTCTGG - Intronic
964579525 3:158217564-158217586 TCTCTACCTTTCCCACATGCAGG + Intronic
964955719 3:162353568-162353590 TATCTAGCTGTCCCACAGACAGG + Intergenic
969840024 4:9874455-9874477 TCTGTGCCCTTCCCACAAAGTGG + Intronic
973655307 4:53041555-53041577 TTTTTACCCTTCCCAAAAGCTGG - Intronic
974559318 4:63495999-63496021 TTTTAACCCTTCCCACAACCAGG + Intergenic
974927808 4:68322741-68322763 TTTCTAACCTTCCCACATCCCGG + Exonic
976436460 4:85023932-85023954 TATATATCCTTCCAAAAAACTGG - Intergenic
977241001 4:94569107-94569129 TAAGTGCCCTTCCCACAAAATGG + Intronic
981528483 4:145731110-145731132 CATCTACCCTTCCTAGAAACAGG - Intronic
983476761 4:168221348-168221370 TATCTACTCTTCTCAAATACTGG + Intronic
984783169 4:183544258-183544280 TCTCTTCCCTCCCCACAAAGTGG - Intergenic
991470293 5:66961607-66961629 AATCTACCTTTCTCAGAAACTGG - Intronic
992227266 5:74631294-74631316 TTTCTGCCCTTCCCACCCACTGG + Intronic
992692187 5:79251675-79251697 TTCCTACCCTTCCCACACTCTGG + Intronic
992708654 5:79426163-79426185 AATATACCTTTCCCACCAACAGG - Intronic
993002424 5:82395093-82395115 TATCTACCATTGCATCAAACTGG - Intergenic
996241714 5:121212023-121212045 TTACTACCCTTCCCAGAATCTGG + Intergenic
997216315 5:132114067-132114089 TTTCTTCCCTTCCCCCAACCTGG - Intergenic
1004456741 6:15798447-15798469 CATCTGCCCTTCTGACAAACTGG - Intergenic
1008360743 6:50615009-50615031 TTTCTACACTTCACTCAAACTGG + Intergenic
1010867365 6:80995588-80995610 TATCTACCCTTCCCAGCCTCTGG + Intergenic
1015679952 6:135795396-135795418 TATCTATTTTACCCACAAACAGG + Intergenic
1015961189 6:138650641-138650663 TGGCTTCCCATCCCACAAACTGG + Intronic
1017516164 6:155157392-155157414 TATTTACTCATCCAACAAACGGG - Intronic
1017710150 6:157160342-157160364 TATCTGCCCATCCCACAAGCTGG + Intronic
1018315277 6:162550452-162550474 CATCTGCCCATCCCCCAAACGGG - Intronic
1018924741 6:168198337-168198359 TGCCCACCCTTCCCACAAAACGG + Intergenic
1020030876 7:4931919-4931941 AATTTACGCTTCCCACCAACTGG + Intronic
1020448063 7:8290927-8290949 TATCAACCCCTCTCACTAACTGG - Intergenic
1020473759 7:8570537-8570559 TATCTGCACTTCCCACAATTGGG - Intronic
1021124407 7:16834328-16834350 TTTCTACTCTTCACTCAAACTGG - Intergenic
1023713448 7:43019146-43019168 TATATACTCTTCCCTCAATCTGG + Intergenic
1028700285 7:93770129-93770151 TATCTACCCTTCCCAGCCTCTGG - Intronic
1039589863 8:38737217-38737239 TATCACGCCTTCCCACCAACTGG + Intronic
1039594781 8:38781741-38781763 ATTCCACCCTCCCCACAAACAGG + Intronic
1039711945 8:40063693-40063715 TATTTATCCTTCCCAAGAACAGG + Intergenic
1041207535 8:55513440-55513462 GAGCTGCCCTTCCCACAAATAGG + Intronic
1045466201 8:102472382-102472404 TTTCTACCGTTCACTCAAACTGG + Intergenic
1047167895 8:122461139-122461161 TATCTACACCTGCCACAAAAGGG + Intergenic
1050202422 9:3159937-3159959 TATATACCCTTCCTAAAATCTGG + Intergenic
1051674921 9:19549116-19549138 TATCTACCATTATCACATACTGG - Intronic
1053293482 9:36897337-36897359 GATCGACCCCTCCCCCAAACTGG - Intronic
1056143461 9:83707279-83707301 CATCAGCCCGTCCCACAAACAGG + Intronic
1060440329 9:123632777-123632799 TTTCCACCCGTCCCCCAAACTGG + Intronic
1186585245 X:10866507-10866529 TATCTACCCTACCTACTCACAGG + Intergenic
1190824664 X:54006499-54006521 TTTCAACCCTTCCCTCAAACAGG + Intronic
1191108498 X:56787622-56787644 TATCTACCCCTACCCCAAAGTGG - Intergenic
1192318107 X:70067358-70067380 TATGTCCCCTTCCCACAGCCGGG - Intergenic
1193342384 X:80364783-80364805 GATCTACCCTACCCACAATTAGG + Intronic
1197152916 X:123239543-123239565 TATCTACTCTGCCTACAAATAGG + Intronic
1197718833 X:129730871-129730893 CATATACCATTCCCACTAACAGG - Intergenic
1201689546 Y:16747713-16747735 TAACTTACATTCCCACAAACAGG + Intergenic