ID: 1131099196

View in Genome Browser
Species Human (GRCh38)
Location 15:89674699-89674721
Sequence ATATGTGAAGGGCCAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131099196_1131099201 27 Left 1131099196 15:89674699-89674721 CCATGGGTTGGCCCTTCACATAT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1131099201 15:89674749-89674771 AGTGCCGCCATCATGTTAAATGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131099196 Original CRISPR ATATGTGAAGGGCCAACCCA TGG (reversed) Intronic