ID: 1131099196

View in Genome Browser
Species Human (GRCh38)
Location 15:89674699-89674721
Sequence ATATGTGAAGGGCCAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131099196_1131099201 27 Left 1131099196 15:89674699-89674721 CCATGGGTTGGCCCTTCACATAT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1131099201 15:89674749-89674771 AGTGCCGCCATCATGTTAAATGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131099196 Original CRISPR ATATGTGAAGGGCCAACCCA TGG (reversed) Intronic
901766111 1:11501180-11501202 ATTGGTGAAGGCCCAGCCCAGGG - Exonic
902516130 1:16990491-16990513 ATATGTGGAGCTCCAGCCCACGG - Intronic
904257773 1:29267279-29267301 ATATATGAAGGGCCAACTATGGG + Intronic
904870649 1:33615751-33615773 AAATGTGAACGGTCAGCCCAAGG - Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
907803122 1:57791249-57791271 ATATGTCAAGTTCCAACACAGGG - Intronic
910219424 1:84875550-84875572 ATCTGGCAAGGGCCATCCCATGG - Intronic
910268611 1:85368305-85368327 AAATGTGGAAGGCAAACCCACGG + Intronic
914807358 1:151001484-151001506 AAAGGTGAACGGCCCACCCAGGG + Intronic
922026697 1:221756416-221756438 ACAAGTGAAGGGCCAACCAGTGG - Intergenic
923541676 1:234892831-234892853 AAGTGTGAAGGGACATCCCATGG + Intergenic
1063238025 10:4139434-4139456 AAATGTGAAGAGCCAAAACAAGG - Intergenic
1063283875 10:4661873-4661895 ACATGTGATAGGCAAACCCATGG - Intergenic
1064605140 10:17031368-17031390 ATATGTAAAGAGCCAAAACAAGG - Intronic
1069890339 10:71648590-71648612 ATATGAGAAGGGGCATCCCTTGG + Intronic
1071588265 10:86846425-86846447 TTATGTGAATGCCCAACACAAGG - Intronic
1072638970 10:97196545-97196567 ATCTGTGAGGGGCGCACCCAGGG + Intronic
1074549125 10:114426947-114426969 ATCTGAGAAGGGCAAACCCAAGG - Intergenic
1075674431 10:124286529-124286551 ATCTGTGAGGGGCCACCCCAGGG - Intergenic
1076310283 10:129501322-129501344 ATATGTGGAGGTCCAACCTTTGG - Intronic
1080625443 11:34025718-34025740 TTATGTCCATGGCCAACCCATGG - Intergenic
1089429501 11:118410910-118410932 ATACTTGAAAGGCTAACCCAGGG + Intronic
1089660035 11:119979733-119979755 GTAGGTGAAGTGCCATCCCATGG - Intergenic
1106175291 13:27325137-27325159 AAATGTTAAGGCCCAACCCCAGG - Intergenic
1108506345 13:51115977-51115999 ATATGTGGAGGGCCGAGCCCAGG - Intergenic
1111337018 13:86838390-86838412 ATCAGTGAAGGGACACCCCAAGG - Intergenic
1113819730 13:113204504-113204526 ATATGTGCAGGGACCACCCTGGG - Intronic
1115321831 14:32088828-32088850 AAATGTGAAGTGCCTAGCCAAGG - Intronic
1116097763 14:40393523-40393545 TTATGTGAAGTCCCAAGCCAAGG - Intergenic
1116104687 14:40487086-40487108 ATATGTCAAGGGCGAATACAAGG + Intergenic
1116420433 14:44726245-44726267 ATGTGAGAAGGGACTACCCAAGG - Intergenic
1126998089 15:54468398-54468420 AAAAGTGAAGAGACAACCCATGG - Intronic
1128449891 15:67799396-67799418 ATCTGTGAAGCACCACCCCAGGG + Intronic
1131099196 15:89674699-89674721 ATATGTGAAGGGCCAACCCATGG - Intronic
1133915747 16:10107976-10107998 ATATGCAAAAGGCCAACCCTGGG + Intronic
1135933095 16:26756272-26756294 AGGTGGGAGGGGCCAACCCAGGG - Intergenic
1138947432 16:61868858-61868880 ATATGTGAAAGGCTAAGCAATGG + Intronic
1141247242 16:82319446-82319468 ATCTTTGGAGGGCCCACCCATGG + Intergenic
1147786057 17:42979719-42979741 ATTTGGGAAGGGACTACCCAGGG + Intronic
1150919790 17:69470602-69470624 ATAAGTGAAGTGCCATCTCATGG + Intronic
1153637930 18:7129080-7129102 ATATGTGTAGGGAGAAACCAGGG + Intergenic
1159464759 18:68767236-68767258 ATATGTGAAGCTCTAACCCTTGG + Intronic
1161309965 19:3588382-3588404 CTATCCAAAGGGCCAACCCATGG - Intronic
1162787879 19:13046955-13046977 CTCTGTGAATAGCCAACCCAGGG - Intronic
1163868462 19:19796295-19796317 ATATGTAAATTGCCAACCCCTGG + Intronic
927338553 2:21953375-21953397 ATATGTCAATTGCCAACCCAAGG - Intergenic
927534081 2:23838460-23838482 AAATCTGAATGGCCAACCCTTGG + Intronic
930709064 2:54533036-54533058 ATATCTGAATTGCCAGCCCAGGG + Intronic
936386880 2:112038718-112038740 ATATCTGAAGGGTGAACACAAGG - Intergenic
936901164 2:117483322-117483344 CTATGTGAAGAGACAACTCATGG - Intergenic
940078391 2:149770407-149770429 ATTTGAGAAGTGCAAACCCAGGG - Intergenic
941700852 2:168603114-168603136 ACATTTAAAGGGCAAACCCAAGG - Intronic
946512031 2:220368366-220368388 ACAAGTGAAGAGACAACCCATGG + Intergenic
946936654 2:224728828-224728850 ATATGGGAAGGTCCAAAACAAGG + Intergenic
947526033 2:230877282-230877304 ACATCAGAAGGGCCAGCCCAGGG + Intronic
947703011 2:232251004-232251026 ATATATGAAGAGACAACCCGAGG + Intronic
1170059431 20:12244013-12244035 AGAGTTGAAGGGCCAACCCAAGG - Intergenic
1173000997 20:39105623-39105645 ACATGTGAAGGGGAACCCCAGGG - Intergenic
1177966810 21:27737762-27737784 AGATATGAAGGGCCAACTAAGGG - Intergenic
1178275855 21:31236306-31236328 AGTTGTGAAGGGCCAACTCTAGG - Intronic
1181165410 22:20980480-20980502 CTATGTGGAGGGCATACCCAGGG - Intronic
1183147710 22:36009927-36009949 AAAGGTGAAGTGCCAACCCGAGG - Intronic
1184354947 22:43973556-43973578 ATATGGGGAGGGACAACCAATGG - Intronic
952989247 3:38817198-38817220 ATTTGTGAGGGGACAAGCCAAGG + Intergenic
953530173 3:43733584-43733606 AGATGTGAAAGGCAAACACAAGG - Intronic
955214284 3:56972068-56972090 AAATGTGAATGAGCAACCCAAGG - Intronic
958634335 3:96723708-96723730 ATCTGTGAAGTTGCAACCCAGGG + Intergenic
960706475 3:120487056-120487078 TTAAGTGAAGAGACAACCCATGG - Intergenic
964127027 3:153244666-153244688 AAATTTGAAAGTCCAACCCAAGG - Intergenic
967221887 3:187254418-187254440 ATATGTAAAGGTCAAAGCCAAGG + Intronic
970619156 4:17799286-17799308 ATATGTGAAGGGCCAACATATGG + Intergenic
973196070 4:47443362-47443384 ACATGTGAAGAAACAACCCAAGG + Intergenic
974771664 4:66422758-66422780 AGATGTGAAGGAACAAGCCAAGG + Intergenic
975724362 4:77277708-77277730 ATAGGTGAGGGGCCAACACCAGG + Intronic
976408472 4:84685994-84686016 ATGTTTGCAGGACCAACCCAAGG + Intronic
977911111 4:102537879-102537901 GTATGTGAAGGCCCATCCCATGG + Exonic
982833458 4:160092133-160092155 ATATGAGTAGGGCCAACTCTGGG - Intergenic
983918723 4:173321123-173321145 ATATGGTGAGGGCCAAACCAGGG + Intronic
984260333 4:177436937-177436959 ATCTGGCAAGGGCCATCCCAAGG - Intronic
984943736 4:184955211-184955233 GAGTGGGAAGGGCCAACCCAGGG + Intergenic
986831735 5:11587484-11587506 ATATGTTAATTGCCTACCCATGG - Intronic
988697640 5:33639428-33639450 TTATGTGAAGGGGAAAGCCATGG + Intronic
991614280 5:68479867-68479889 AAATGTCAAGAGCCAACACAGGG + Intergenic
994493679 5:100482342-100482364 ATATGTGAAGGTCAAAGCAAGGG + Intergenic
999845060 5:155470212-155470234 ATCTGGGAGTGGCCAACCCAGGG - Intergenic
1000712338 5:164596226-164596248 AAATCTGAAGGCTCAACCCAAGG - Intergenic
1001951487 5:175819798-175819820 AGAGGTGAAGGGCCTGCCCAAGG + Intronic
1005947837 6:30607742-30607764 AAAAGTGAAGGGACAATCCAAGG + Intronic
1008407397 6:51134570-51134592 ATATGTAAAGGAACAACCAATGG - Intergenic
1011994004 6:93562042-93562064 ATATGTGAAGGGCCAGGCCTGGG - Intergenic
1012744724 6:103071295-103071317 AAAAGTGAAGAGACAACCCATGG + Intergenic
1012823597 6:104120983-104121005 CGATGTGAAGAGACAACCCATGG - Intergenic
1014203341 6:118627989-118628011 ATCTGTGAAGTTACAACCCAGGG + Intronic
1015790763 6:136962263-136962285 AAATCTGAATGGCCAACCCATGG - Intergenic
1017093979 6:150787775-150787797 ATATGTAAAGGCACAATCCATGG + Intronic
1017193993 6:151681104-151681126 ATAAGTGAAGGTCCAAACCAAGG - Intronic
1027232001 7:76278184-76278206 ATCTCAGAGGGGCCAACCCAAGG + Intronic
1027771105 7:82407300-82407322 ATATGAGAAGCTCTAACCCAAGG - Intronic
1032401582 7:131628005-131628027 CTAAATGAAGGGCCAGCCCAAGG - Intergenic
1032474107 7:132200612-132200634 ACATGTTGAGGGCCACCCCAAGG + Intronic
1035249764 7:157589263-157589285 ATATGGGAAGTGCCTGCCCAGGG + Intronic
1042427709 8:68668344-68668366 ATATTTGAAGGGCAATTCCATGG + Intronic
1050283513 9:4077559-4077581 ATAGCTTAACGGCCAACCCAGGG - Intronic
1052305276 9:27001759-27001781 AAAAGTGAAGAGACAACCCACGG - Intronic
1059634229 9:116155712-116155734 ATCTGTGAAAGTCCAAGCCATGG - Intronic
1060353179 9:122877761-122877783 ATATCTGAAGTGCCAATTCAGGG - Intronic
1060422105 9:123476592-123476614 CTTTGTGAAGGTCTAACCCATGG - Intronic
1186537128 X:10361701-10361723 AAATGTGAAGAGCCAATCAAAGG + Intergenic
1188400177 X:29734805-29734827 ATTTGTGAAGGGGAAACCTAAGG + Intronic
1189287722 X:39863810-39863832 ACATGAGAAGGGACTACCCATGG + Intergenic
1195212492 X:102663044-102663066 ATATATGAAGGGAAAAACCAAGG - Intergenic