ID: 1131101303

View in Genome Browser
Species Human (GRCh38)
Location 15:89691980-89692002
Sequence CTGGAAACACAGCTGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131101297_1131101303 -3 Left 1131101297 15:89691960-89691982 CCCTAGACTCCTTAGAATACCTG 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG 0: 1
1: 0
2: 1
3: 25
4: 298
1131101298_1131101303 -4 Left 1131101298 15:89691961-89691983 CCTAGACTCCTTAGAATACCTGG 0: 1
1: 0
2: 1
3: 9
4: 141
Right 1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG 0: 1
1: 0
2: 1
3: 25
4: 298
1131101296_1131101303 16 Left 1131101296 15:89691941-89691963 CCAGGTTCATCTTCAGAATCCCT 0: 1
1: 0
2: 0
3: 18
4: 225
Right 1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG 0: 1
1: 0
2: 1
3: 25
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131101303 Original CRISPR CTGGAAACACAGCTGGAATA TGG Intronic
902356858 1:15909310-15909332 CTGGAATCACTGCTGCAAAAAGG - Exonic
903850427 1:26302521-26302543 CTGCAAACACAGATGGTCTACGG - Intronic
905416944 1:37810145-37810167 CTGAGAACACAGCAGGAAAAGGG + Exonic
907026992 1:51129749-51129771 CTGAAAACACAGCAAGAAAAAGG - Intronic
907249056 1:53125829-53125851 GTGTAAACAGAGCTGGAACATGG - Intronic
908518341 1:64916353-64916375 ATGAAAACACAGCTGGGAAAGGG + Intronic
908597505 1:65704154-65704176 CTTGAAACACAGCTGGTATTAGG - Intergenic
910867246 1:91799701-91799723 CTGAAAACACATCTGCAAAAAGG + Intronic
911268568 1:95773463-95773485 CTTAAAACACAATTGGAATAAGG + Intergenic
911640397 1:100282380-100282402 CTTGAAAAACAGCTAAAATAGGG - Intronic
913669024 1:121077386-121077408 ATGGAAACACAGCTGATTTAGGG - Intergenic
914020769 1:143864821-143864843 ATGGAAACACAGCTGATTTAGGG - Intergenic
914659265 1:149772747-149772769 ATGGAAACACAGCTGATTTAGGG - Intergenic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
917742621 1:177975807-177975829 CTGGAAACAGTCCTGGGATATGG + Intronic
917769476 1:178261433-178261455 ATAAAAACACAGGTGGAATATGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
922518486 1:226225496-226225518 CTGGAACCATACCTGGAAGAGGG - Exonic
924193242 1:241578170-241578192 CTGCAAACACAGTGGGAATGGGG - Intronic
1063979596 10:11443003-11443025 ATGGAAACACAGGTCAAATAAGG + Intergenic
1064544611 10:16437961-16437983 CTGGAACCAGAACTAGAATAGGG - Intronic
1064673254 10:17737008-17737030 CTGGAGACCCAGCTTGCATACGG - Intergenic
1065814419 10:29471193-29471215 CTGGAAACACTGCAGGAAACAGG + Exonic
1067036694 10:42926042-42926064 CTAAAAACACAGCTGGAATCAGG - Intergenic
1067158708 10:43804141-43804163 CTGGAAACTCACCTGGAAAACGG + Intergenic
1067439784 10:46302097-46302119 CTGGAATCACAGCTAAAACAGGG + Intronic
1067674667 10:48362089-48362111 CAGGAAATAAAGCTGGAAAAAGG - Intronic
1068042637 10:51845242-51845264 CTGGAAAGACAGCAAGAAGAGGG - Intronic
1068043624 10:51858693-51858715 GTGGCACCACACCTGGAATATGG - Intronic
1068148147 10:53097782-53097804 CTGTAAAAGCAGCTAGAATAGGG + Intergenic
1070183191 10:74034334-74034356 CAGGAAACATAGCTGGAAAATGG - Intronic
1073937221 10:108648048-108648070 TTGGGAACACAGCAGGCATAGGG - Intergenic
1074024364 10:109618968-109618990 TAGGAAACACAGCTGTAAAATGG - Intergenic
1074438198 10:113452437-113452459 CTGGGAACAGTGCTGGAATGGGG + Intergenic
1074935798 10:118180356-118180378 GTGGGGACACAGCTAGAATATGG - Intergenic
1075348734 10:121704757-121704779 CCGGAAACACATCTGTAATATGG - Intergenic
1075552591 10:123403060-123403082 TTCCAAGCACAGCTGGAATATGG + Intergenic
1076621822 10:131793870-131793892 CTGGAAAAAAAGGTGGAAAAGGG - Intergenic
1076853578 10:133104679-133104701 CAAGGAACACAGCTGGAACACGG - Intronic
1077209828 11:1364783-1364805 CTGGAAACACTGCTGGTACCAGG + Intergenic
1077719770 11:4616193-4616215 CCAGAAACACAACTGAAATATGG - Intergenic
1078430146 11:11281989-11282011 CTGGGAACACATCTGGGATATGG + Intronic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1079322466 11:19462892-19462914 CTGGAAACAGAGCTGATATAGGG - Intronic
1081325079 11:41734688-41734710 CAGGAAGCACAGCTGGAATGGGG + Intergenic
1081408192 11:42722634-42722656 CTGGAATCAAAGCTGAGATAGGG - Intergenic
1082204494 11:49416133-49416155 TTGGAAACAGTGCTGGAATTTGG + Intergenic
1083625771 11:64071307-64071329 CTGGGATCCCAGCTGGAATCAGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1087998766 11:104847651-104847673 CTCCAAACACAGCTGGATTAAGG - Intergenic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1089692425 11:120195232-120195254 CAGGAAAGAAAGCTGGAATTAGG - Intergenic
1091223529 11:133944809-133944831 CTGGAAATGCTGCTGGGATAGGG - Intronic
1091571234 12:1688450-1688472 CTGGAGCCACAACTGGATTATGG + Intergenic
1093061578 12:14612890-14612912 CTGGAACAACTGCTGGAATAAGG + Exonic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1098084873 12:66831638-66831660 GTGGTCACACAGCTGGAAAATGG + Intergenic
1098761311 12:74428651-74428673 ATAGCAACACAGATGGAATAAGG + Intergenic
1099887801 12:88553292-88553314 CTGGAAACTCTGAGGGAATAGGG + Intronic
1100605453 12:96148765-96148787 CTGGAAAAATAGATGGAATGAGG + Intergenic
1101978359 12:109382724-109382746 AGTGAAACACAGCTGGAATAGGG + Intronic
1102529155 12:113533257-113533279 CTGGAACCACAGCCGGGAGATGG - Intergenic
1102849429 12:116225784-116225806 GTGGAAAGACTGCTTGAATAAGG - Intronic
1103165193 12:118764498-118764520 ATGGCCACACAGCTGGAATTGGG - Intergenic
1105801717 13:23909825-23909847 CAGGAAAGACAGCATGAATAGGG - Intergenic
1106157210 13:27170853-27170875 CTGGACACACGGCTGGAAACGGG + Intronic
1106594485 13:31124728-31124750 CACAAAACACAGCTTGAATAAGG - Intergenic
1108002046 13:45912664-45912686 CTGGAAGCACAGCTTGAAGATGG - Intergenic
1109914209 13:68959193-68959215 TTGGAAACACAGAGGGAATTAGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1114274985 14:21134917-21134939 GTGGAAACAAAACTGGAAGAAGG - Intergenic
1118242586 14:64074380-64074402 CTGGAAACATAGTTGAAAGAAGG - Intronic
1123033397 14:105461664-105461686 CTGGAGACGCATCTGGAATTCGG + Intronic
1123680897 15:22762792-22762814 CAGGGAGAACAGCTGGAATACGG - Intergenic
1124998133 15:34743942-34743964 CTGGAAAGTAAGCTGGAATAAGG - Intergenic
1125840120 15:42792593-42792615 ATCGAAAGACAGCTGGAGTATGG + Intronic
1127718832 15:61679738-61679760 CTGGAAACCAAGCTAGAACAGGG + Intergenic
1127894189 15:63280299-63280321 TTTGAAACACAGCTGGAACTTGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1128638689 15:69319595-69319617 TTGGAAACACAGCTGGGCTTGGG + Intronic
1128686123 15:69687041-69687063 CTAGAAACACATCTGGAGTTGGG + Intergenic
1129031738 15:72623655-72623677 CTGGAAACACATCTGAATTCTGG + Intergenic
1129218199 15:74113809-74113831 CTGGAAACACATCTGAATTCTGG - Intronic
1130889059 15:88117924-88117946 CTGGAAGCACAGCTGGCTGAAGG + Intronic
1131031658 15:89191236-89191258 GTGGAAGCTCAGCTGGAATCTGG + Intronic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1132536334 16:482936-482958 CAGGAAAGTCAGCTGGAACAGGG - Intronic
1133023381 16:2976709-2976731 CTGGAAGCTCTGCTGGAAGAAGG + Exonic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1137669712 16:50272056-50272078 CAGGAAACACAACTGGAAACGGG - Intronic
1139264953 16:65629874-65629896 CTGCAAACACTACAGGAATATGG + Intergenic
1139712005 16:68782995-68783017 CTGAAAACACAACTGAAATCTGG + Intronic
1139877728 16:70159807-70159829 CTGCAAATCCAGCAGGAATAAGG + Exonic
1140192676 16:72831351-72831373 CTGGGAATACAGGTGAAATACGG + Intronic
1141159641 16:81620569-81620591 CTGCACACACAGCTGGACTTAGG - Intronic
1141538294 16:84699219-84699241 CTGAAATCACAGCTAGAAAAGGG + Intergenic
1142600490 17:1051346-1051368 CTGGGAACCCAGCTGGCACACGG + Intronic
1144877509 17:18409125-18409147 CTGGAAACACAGTTGTGAAAAGG - Intergenic
1145058822 17:19719753-19719775 CTGCAGACACAGCTAGACTAGGG - Intergenic
1145118694 17:20236097-20236119 GTGGCAAGACAGCTGGAAAAGGG - Intronic
1145154717 17:20535277-20535299 CTGGAAACACAGCTGTGAAAAGG + Intergenic
1145902933 17:28499729-28499751 CTGGGGACACAGCTCGAATCAGG - Intronic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1147406764 17:40217999-40218021 CAGGGAACACAGCAGGCATAGGG - Intergenic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1149890952 17:60390436-60390458 CTGGAAACACATCAAGAATTTGG + Intronic
1150624716 17:66834576-66834598 GAGGACACACAGCTGGAAAATGG - Intergenic
1151073784 17:71247908-71247930 CTAGAAACATACCTGGAAGAAGG - Intergenic
1151185634 17:72361969-72361991 CTGGAAACCCAACTGGTATGCGG + Intergenic
1153140313 18:1964645-1964667 TGGGAAAAACAGCTGGAAAAAGG + Intergenic
1153340874 18:3973532-3973554 CAGGAACCACAGGTGAAATAGGG - Intronic
1153444112 18:5153026-5153048 CTTGAAACACAGATGGACTTTGG + Intronic
1155047209 18:22113531-22113553 CAGGAAACACTGCAGGAATCCGG - Intergenic
1155506052 18:26533957-26533979 ATTGAAACACATTTGGAATATGG + Intronic
1155671926 18:28381980-28382002 ATGGGAACACAGCTGGTAAAGGG + Intergenic
1156184904 18:34651588-34651610 CTGGAAATACAGCTGCCAGAAGG + Intronic
1156521505 18:37725746-37725768 CAGGTAACACAGCTGGTAAATGG + Intergenic
1157809369 18:50683795-50683817 CTGGCAACACAGCTGGATGTAGG + Intronic
1158041843 18:53103900-53103922 CTAGAAACACAGCTGGACTAGGG + Intronic
1158511981 18:58098528-58098550 GTGGTCACACAGCTGGAAGATGG - Intronic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1159307950 18:66670120-66670142 GTGGGAATACAGCTGGAATTAGG - Intergenic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162901399 19:13797011-13797033 CTAGAAACCCAGGTGGAGTAGGG + Intronic
1163534642 19:17870176-17870198 CTGGAAACCCCGTTGGAAAAGGG - Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168113798 19:54209589-54209611 CTGGACACACAGCAGGGAGATGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
925642463 2:5999135-5999157 CTGGAAACACAGCCAGAAGGTGG - Intergenic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
927702919 2:25279337-25279359 CTGAAAAGAGACCTGGAATAAGG + Intronic
929236903 2:39615238-39615260 CTTCAAGCACAGCTGGATTAAGG - Intergenic
930896910 2:56457067-56457089 GTGAAAACATAGCTGGAATAAGG - Intergenic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
937053458 2:118911201-118911223 CTGGAACATCTGCTGGAATAAGG + Intergenic
937085284 2:119167595-119167617 CATGAAACACAGCTGTAATGAGG + Intergenic
937839199 2:126508639-126508661 GTGGAAACAGAGCAGGCATATGG + Intergenic
938777927 2:134558507-134558529 ATAGAAAGACAGCTGGAAAATGG + Intronic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939649401 2:144742803-144742825 CTGCAAAAACAGCTGCAAAATGG - Intergenic
940867200 2:158829352-158829374 CAGGAGACACAGCTGCAAAAGGG + Intronic
945881959 2:215334081-215334103 ATGGAAACACAATTGGAATTTGG + Intronic
946304573 2:218848501-218848523 CTGGAAGCAGTGCTGGAAGAAGG - Intergenic
948173087 2:235922049-235922071 CTGGAATCACAACTGGATGAAGG - Intronic
1169724593 20:8715298-8715320 TTGTAAACACAGCTGATATAGGG - Intronic
1170615252 20:17943505-17943527 CTGGGAACAGGGCTGGAGTATGG + Intronic
1170745858 20:19098371-19098393 CTGCAAAGAAAGCTGGAACATGG + Intergenic
1171526134 20:25813002-25813024 CTAGAAGCAGAGCTGGAGTAAGG + Intronic
1171550693 20:26042883-26042905 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1172425705 20:34854620-34854642 CTGAAAATACAGCAGGGATATGG + Intronic
1172505814 20:35461629-35461651 CAGGCCACACAGCTGGCATATGG - Intronic
1173062951 20:39679739-39679761 CTGGCAACACTGCCAGAATAGGG - Intergenic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1174336457 20:49864991-49865013 CTAGAAACACATCTGGATTTAGG + Intronic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176057255 20:63155320-63155342 CTGGCAGGGCAGCTGGAATACGG + Intergenic
1176667317 21:9699726-9699748 ATGGAAACACCAGTGGAATAAGG - Intergenic
1176667380 21:9700001-9700023 ATGGAAACACCAGTGGAATAAGG - Intergenic
1177217357 21:18147396-18147418 TTGGGAACACAACTAGAATAGGG - Intronic
1177831169 21:26140603-26140625 CTGGCAAAACAGCTAGAATCAGG + Intronic
1179711981 21:43268777-43268799 CTGGCAACTCAGCTGGAAATGGG - Intergenic
1180013400 21:45066174-45066196 CTGGAAAGACTGCTGGTACAAGG + Intergenic
1181440151 22:22931546-22931568 CTGGAAACCCAGCAGGGTTAAGG + Intergenic
1183004014 22:34885234-34885256 TTGGAAACACATCTGGGATAAGG + Intergenic
1184244166 22:43227497-43227519 CTGGAAGCACAGCGGGCGTAAGG + Intronic
1203292714 22_KI270736v1_random:10796-10818 CTGGAAATACAGCTCAAATCTGG + Intergenic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
950214329 3:11147839-11147861 GTGGAAACAGGGCTGGAATGAGG - Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
952154410 3:30627188-30627210 CTAGAGACACCTCTGGAATAAGG + Intronic
952365199 3:32668182-32668204 TTGGAAACACTGCTGAAATTTGG + Intergenic
952760833 3:36912758-36912780 CTGGCAACACAGATGGCCTATGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
956706581 3:72004394-72004416 CTGGTATCACAGCTGGAGTGTGG - Intergenic
958543655 3:95511877-95511899 CTCCTAACACAGCTGTAATATGG + Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
960045984 3:113199052-113199074 CTTGAAAAACTTCTGGAATATGG - Intergenic
960136858 3:114114222-114114244 CTGGCACCACAGCTGCAATTAGG - Intergenic
960968143 3:123119764-123119786 GCTGAAACACAGCTGGATTAGGG + Intronic
961103524 3:124221861-124221883 CTGGAAACTCAGCAGAAATTGGG + Intronic
962309602 3:134315732-134315754 CTAGTCACACAGCTGGGATATGG + Intergenic
962367854 3:134797592-134797614 ATGGAAACACAGCAGGCATGAGG + Intronic
962974377 3:140433385-140433407 GTGGAACCACAGCTAGAATCAGG + Intronic
963043489 3:141085842-141085864 CTGCAAACAGAGCTGGCACATGG + Intronic
963472824 3:145764085-145764107 CTGGAGACACATCAGAAATAAGG + Intergenic
965816831 3:172644730-172644752 CTGGAAACATCCCTGGCATATGG - Intronic
970204405 4:13641719-13641741 CTGGAATCACACCTGTAATGGGG - Intergenic
970909569 4:21258885-21258907 ATTGAAACATAGCTAGAATACGG + Intronic
972351936 4:38244187-38244209 ATGGAAACACAGCAGGATGAAGG - Intergenic
972722789 4:41717454-41717476 ATGAAAACAAAACTGGAATAAGG + Intergenic
975678975 4:76856495-76856517 ATGGAAAGAAAGCTGGAAAAAGG - Intergenic
977171412 4:93767364-93767386 CTGGAATGGAAGCTGGAATAAGG + Intronic
977808559 4:101332799-101332821 ATGGACACACAGTTGGCATATGG + Intronic
980225939 4:129985717-129985739 TGGGAACCACAGCTGGGATAGGG + Intergenic
980808195 4:137840781-137840803 CTGCAAATTCAGCTGAAATAAGG + Intergenic
982743940 4:159086830-159086852 CTGGAAAAACAGCTGGTGTGTGG + Intergenic
982972354 4:162005190-162005212 CAGGAAACAGAGCTGGAAGTTGG - Intronic
983566876 4:169162789-169162811 CTGGAACCAGGTCTGGAATAAGG - Intronic
984450315 4:179892388-179892410 ATGGAAATACAGCTAGAAAATGG + Intergenic
985275940 4:188237890-188237912 CTGGAATGACAGCTGGGATAAGG - Intergenic
985407427 4:189651593-189651615 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407439 4:189651637-189651659 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407463 4:189651725-189651747 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407475 4:189651769-189651791 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407487 4:189651813-189651835 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407499 4:189651857-189651879 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407511 4:189651901-189651923 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407523 4:189651945-189651967 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407547 4:189652033-189652055 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407559 4:189652077-189652099 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407571 4:189652121-189652143 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407595 4:189652209-189652231 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407616 4:189652298-189652320 ATGGAAACACCAGTGGAATAAGG + Intergenic
985407668 4:189652520-189652542 ATGGAAACACCAGTGGAATAAGG + Intergenic
986720340 5:10556614-10556636 CTGTAAACAGAGCTGGAAAGTGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
989588355 5:43090682-43090704 CAGGAGGCACAGCTGGACTAGGG + Intronic
994666850 5:102715616-102715638 CTGGATAAACATCTGGAATGAGG + Intergenic
998717685 5:144904663-144904685 CTGGAAAAACTGCTTGAACATGG + Intergenic
999717699 5:154375102-154375124 GGGGAAACACAGCTAGAAGAAGG + Intronic
999763968 5:154724143-154724165 GTAGAAAGAAAGCTGGAATAAGG + Intronic
1000966203 5:167659957-167659979 CTGTAAATACACCTGAAATAAGG + Intronic
1004001794 6:11602893-11602915 CGGGAAACACAGTTTGAAAAAGG - Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007486793 6:42185984-42186006 CCGGGAACTCAGCTGGAATTAGG - Intronic
1008357227 6:50568990-50569012 CTGGTAACAAAGCAGGAATGAGG + Intergenic
1008867294 6:56228104-56228126 CAGGAAACAGAGCAGGAACATGG + Intronic
1008878147 6:56351728-56351750 TTGGAACCACTGCTGGAAGAAGG + Intronic
1010547485 6:77175360-77175382 CTGGAAACAATGGTGAAATATGG + Intergenic
1010769736 6:79814638-79814660 CTTCAAACACAACTGGAATTGGG - Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012827075 6:104160037-104160059 CTAGAAACACAGGTGGCAGAGGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013482055 6:110561407-110561429 CTGGGAACACAGCATGAACAAGG + Intergenic
1015026605 6:128541016-128541038 CTTTAAAAACAGCTGGATTATGG - Intergenic
1015205137 6:130629082-130629104 CTGGAAACAGTGATGAAATAAGG - Intergenic
1016558982 6:145373143-145373165 CTTGCTGCACAGCTGGAATAAGG + Intergenic
1016711615 6:147179618-147179640 CTGGAAATATAACTGGAATTGGG - Intergenic
1017477827 6:154816202-154816224 GTGGAGACACAGCTGGACTTAGG + Intronic
1018234584 6:161711718-161711740 CTGCCAGCACAGCTAGAATAAGG + Intronic
1018932964 6:168254031-168254053 GTGGGAACAGAGCTGGACTAGGG - Intergenic
1021310555 7:19090667-19090689 CTGCAAGTGCAGCTGGAATAAGG - Intronic
1022053014 7:26698099-26698121 CTGGAAAAACAGCTGATATATGG + Intronic
1024255990 7:47540373-47540395 TTGGAAACCCAGCTGGAACTAGG + Intronic
1025299542 7:57807136-57807158 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1026165823 7:67908429-67908451 CTGGGATCACAGCTGCAATTGGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1027722556 7:81762524-81762546 ATGGAAACATAGCTTGAGTAAGG - Intronic
1028004944 7:85553279-85553301 CTAGAAACACAGCTACTATATGG + Intergenic
1028890634 7:95984488-95984510 CTTGAAAAACAGCTTAAATATGG - Intronic
1029175691 7:98662805-98662827 CAGGAAAGACAGCTGAAACAAGG + Intergenic
1029179150 7:98687317-98687339 TTGGACACAAAGCTGGAAAATGG + Intergenic
1030650730 7:112113289-112113311 CTGGTAAAACAGCTGGGATGAGG + Intronic
1030685566 7:112483725-112483747 CTGGCAGCAGAGCTGGAATCGGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1033670842 7:143491258-143491280 CTGGAGACTAAGCTGGAACAAGG + Intergenic
1035611347 8:966810-966832 GTGGAAATAAAGCTGGAAGAAGG - Intergenic
1035892816 8:3363989-3364011 CAGGAAACACTGCTTTAATAAGG + Intronic
1037071222 8:14651979-14652001 CAGGAAACACAGCTGGTAGTAGG - Intronic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1038441835 8:27576113-27576135 ATGGAATCACAGCTAGAAGACGG + Intergenic
1039591814 8:38756410-38756432 CTGGAAAAAGCGCTAGAATAAGG + Intronic
1039803185 8:40977387-40977409 CAGGAAATACACCTGGAATTTGG - Intergenic
1043217260 8:77607408-77607430 CTTGAAACCCAGCTTTAATATGG - Intergenic
1045311353 8:101006018-101006040 CTGGAAGCAAAGGTGGAATTTGG + Intergenic
1046782855 8:118233799-118233821 CTGGTAAAACAGCTGGGTTAGGG + Intronic
1046987709 8:120407749-120407771 CTGGACTTACAGCTGAAATAGGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048252163 8:132875820-132875842 CTGGAAGCCCAGCTGTAATCAGG + Intronic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1050713677 9:8495085-8495107 CTGGAAATAAATCAGGAATATGG - Intronic
1052540080 9:29799768-29799790 CTGGAAACACAGCAAGATCATGG + Intergenic
1053306001 9:36985384-36985406 CTGAAAACAGAACTGGAAAAGGG + Intronic
1053794041 9:41708892-41708914 CTAGAAGCAGAGCTGGAATAAGG + Intergenic
1054151131 9:61605935-61605957 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1054182451 9:61920931-61920953 CTAGAAGCAGAGCTGGAGTAAGG + Intergenic
1054470909 9:65537047-65537069 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1054656058 9:67667548-67667570 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1055009787 9:71552773-71552795 CTGGAAGCAAAGCTAGAAGACGG - Intergenic
1058768980 9:108212002-108212024 CTGGAAAGGAAGCTCGAATAAGG - Intergenic
1058909290 9:109506240-109506262 CTGGAAAGGCAGCAGTAATAGGG + Intergenic
1059411620 9:114136133-114136155 CTGGAATCACAGCTCCAAGATGG - Intergenic
1059745465 9:117196146-117196168 AAGGTAACACAGCTGGAGTATGG - Intronic
1059761567 9:117342688-117342710 CTGAAAACACAGTTTGAAAATGG - Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061324436 9:129854866-129854888 TTACAAACACAGCTGGAATCTGG + Intronic
1061510322 9:131057087-131057109 CAGGGGACACAGCTGGCATAGGG - Exonic
1061558161 9:131384888-131384910 GTGGAACCAGAGCTGGAAGATGG + Intergenic
1061572437 9:131486062-131486084 CTGGAAACAGAGCGGCAAAAGGG - Intronic
1203658435 Un_KI270753v1:20697-20719 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658531 Un_KI270753v1:21106-21128 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658573 Un_KI270753v1:21285-21307 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658585 Un_KI270753v1:21329-21351 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658621 Un_KI270753v1:21462-21484 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658633 Un_KI270753v1:21506-21528 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658673 Un_KI270753v1:21638-21660 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658685 Un_KI270753v1:21682-21704 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658697 Un_KI270753v1:21726-21748 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658709 Un_KI270753v1:21770-21792 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658721 Un_KI270753v1:21814-21836 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658733 Un_KI270753v1:21858-21880 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658745 Un_KI270753v1:21902-21924 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658757 Un_KI270753v1:21946-21968 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658769 Un_KI270753v1:21990-22012 ATGGAAACACCAGTGGAATAAGG + Intergenic
1203658781 Un_KI270753v1:22034-22056 ATGGAAACACCAGTGGAATAAGG + Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186257631 X:7739950-7739972 CTGGTCACACAGCTAGAAAATGG + Intergenic
1188694712 X:33176385-33176407 ATAGAAACTCAGCTGAAATAAGG + Intronic
1190747430 X:53332747-53332769 CTGAAAACAGAGCTTGAAAATGG - Intergenic
1194147459 X:90281075-90281097 CAGGAATCATAGCTGGAAAATGG - Intergenic
1194565043 X:95475806-95475828 CTGGAAAAATATCTGGCATATGG - Intergenic
1199462163 X:148096700-148096722 CAGGAATCACAGCTTTAATAGGG + Intergenic
1200493860 Y:3857837-3857859 CAGGAATCATAGCTGGAAAATGG - Intergenic