ID: 1131103100

View in Genome Browser
Species Human (GRCh38)
Location 15:89709293-89709315
Sequence TTGGATCCTGAGGCTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 607}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131103094_1131103100 -8 Left 1131103094 15:89709278-89709300 CCAGCTGAGAATGCCTTGGATCC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG 0: 1
1: 0
2: 7
3: 58
4: 607
1131103088_1131103100 25 Left 1131103088 15:89709245-89709267 CCCACTGTGGCAGAGACAAAAGC 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG 0: 1
1: 0
2: 7
3: 58
4: 607
1131103089_1131103100 24 Left 1131103089 15:89709246-89709268 CCACTGTGGCAGAGACAAAAGCA 0: 1
1: 0
2: 4
3: 20
4: 290
Right 1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG 0: 1
1: 0
2: 7
3: 58
4: 607
1131103093_1131103100 -5 Left 1131103093 15:89709275-89709297 CCACCAGCTGAGAATGCCTTGGA 0: 1
1: 0
2: 2
3: 23
4: 184
Right 1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG 0: 1
1: 0
2: 7
3: 58
4: 607
1131103087_1131103100 26 Left 1131103087 15:89709244-89709266 CCCCACTGTGGCAGAGACAAAAG 0: 1
1: 0
2: 0
3: 28
4: 294
Right 1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG 0: 1
1: 0
2: 7
3: 58
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131103100 Original CRISPR TTGGATCCTGAGGCTGGGCA GGG Intronic
900270650 1:1785759-1785781 TTGGATTCTGAGGGTGGGGAGGG - Exonic
900343830 1:2201427-2201449 AAGGGACCTGAGGCTGGGCACGG + Intronic
900437420 1:2637917-2637939 CTGGATGCTGAAGCTTGGCATGG + Intronic
900593796 1:3471422-3471444 TGGGGCCCTGAGGGTGGGCAGGG + Intronic
901061618 1:6474366-6474388 TGGGAACCTGAGCCTGGGAAGGG + Intronic
901252203 1:7788611-7788633 TTGGATCATTAGGCTGGGCAAGG + Intronic
901337432 1:8463262-8463284 TTTGATCCTGAGGCTCTACAAGG + Intronic
901396080 1:8982816-8982838 TATGAGCATGAGGCTGGGCACGG + Intergenic
901438193 1:9262329-9262351 GTGGGCCCTGGGGCTGGGCATGG + Intronic
901463235 1:9404220-9404242 TTGGACCCGGAGGGTGGTCATGG + Intergenic
901921284 1:12539573-12539595 TTTGAACCTGAGGGTGGACAGGG - Intergenic
902043022 1:13506150-13506172 TGGGCTCCTGAGGCTGGGTTGGG - Intronic
902613185 1:17609071-17609093 AAGGAGCTTGAGGCTGGGCATGG - Intronic
902734916 1:18394174-18394196 CCTTATCCTGAGGCTGGGCAAGG - Intergenic
903162099 1:21496447-21496469 TGGAATCCTGAGGCAGTGCAGGG + Intergenic
903235818 1:21950137-21950159 CAGGTCCCTGAGGCTGGGCACGG + Intergenic
903451736 1:23458188-23458210 TTAAAACATGAGGCTGGGCATGG + Intronic
903503208 1:23813556-23813578 TTGCAGCCAGAGGCCGGGCATGG - Intronic
903972962 1:27131039-27131061 CTGGCTGCTGAGACTGGGCAGGG + Intronic
904279007 1:29405337-29405359 TAGTATCCTGAGGCTGTGCAGGG - Intergenic
904406081 1:30288979-30289001 TGGGATCCTGAGACTTGGAATGG + Intergenic
904617374 1:31757185-31757207 TTGGATGGTGAGGCTGGGGCTGG - Exonic
904825099 1:33269120-33269142 TTTGAGGCTGAGGCTGTGCAGGG + Intronic
904983183 1:34523799-34523821 TTGGAACCTGTGGCAGGTCATGG + Intergenic
905225098 1:36473708-36473730 TTGGATTCTGGGGTAGGGCATGG - Intronic
905340316 1:37273536-37273558 CTGGATGCTGAGAGTGGGCAAGG - Intergenic
905576154 1:39046297-39046319 TTTGACTCAGAGGCTGGGCATGG - Intergenic
906504549 1:46368760-46368782 TTTGTTCTTTAGGCTGGGCATGG + Intergenic
907410979 1:54282974-54282996 TAGGAACCAGAGGCTGGGCGTGG + Intronic
911497563 1:98650185-98650207 TGTGATCCTGAGGCTGGACCAGG + Intergenic
912183085 1:107241980-107242002 TTTGATCTTTAGGCCGGGCATGG + Intronic
912534873 1:110359795-110359817 TTTGACCTTCAGGCTGGGCACGG + Intergenic
913164109 1:116169298-116169320 TGGGTGCCTGAGGCTGGGCTAGG - Intergenic
915114354 1:153586788-153586810 AAGCATCCTAAGGCTGGGCATGG + Intergenic
915553817 1:156650237-156650259 CTGGATCATGAGGAGGGGCAGGG + Intronic
916031011 1:160877661-160877683 TTGAATACAGAGGATGGGCAAGG - Intronic
916571340 1:166030548-166030570 ATGGTGCCTGAGGCTGGGGATGG - Intergenic
918113324 1:181476871-181476893 TTGGGCCCTGAGGGTGGGAAGGG + Intronic
918506999 1:185266352-185266374 TTTAATTCTAAGGCTGGGCACGG - Intronic
920234040 1:204491095-204491117 ATGAATTCTGAGGCTGGACATGG + Intronic
920400767 1:205675004-205675026 ATGGATACTTAGGCTGGGCGCGG - Intronic
920697995 1:208196227-208196249 TTCATTCCTGAAGCTGGGCAGGG - Intronic
921861222 1:220044432-220044454 ATGTATCAGGAGGCTGGGCATGG + Intronic
921917533 1:220628794-220628816 ATGTATCATGTGGCTGGGCATGG + Intronic
922310974 1:224390409-224390431 TGAGATTCTGAGGCTAGGCACGG - Intronic
923044223 1:230343652-230343674 GTGGATTCAGAAGCTGGGCAGGG - Intronic
923059557 1:230458136-230458158 CTGTTTTCTGAGGCTGGGCACGG - Intergenic
923383983 1:233448513-233448535 TTGTAGGCTGAGGCTGGGCCCGG - Intergenic
924098651 1:240580861-240580883 TTGGATATCTAGGCTGGGCATGG - Intronic
924790798 1:247245880-247245902 TTGGATCTTGCAGTTGGGCAAGG - Intergenic
924928529 1:248706559-248706581 TTGGATCCTGAGACAGAGCAGGG - Intergenic
1062841128 10:672816-672838 TAGAATCAGGAGGCTGGGCAGGG - Intronic
1062922417 10:1290158-1290180 TTGGTGCCTGAGGCTTTGCAAGG + Intronic
1063009808 10:2011271-2011293 GTGGCCCCTGTGGCTGGGCAAGG + Intergenic
1063613481 10:7582823-7582845 TGGTTTCCAGAGGCTGGGCAGGG + Intronic
1064032002 10:11888535-11888557 TTGACTCCAGAGCCTGGGCAGGG + Intergenic
1064470418 10:15629634-15629656 TTGTCTTCAGAGGCTGGGCATGG + Intronic
1064600353 10:16986326-16986348 GTGGGTCCTGAGGGTGGGCAAGG - Intronic
1065138898 10:22701459-22701481 TGGGAACCTGAGCTTGGGCAGGG - Intronic
1065456608 10:25912664-25912686 TTGCAAACGGAGGCTGGGCATGG - Intergenic
1065632448 10:27694388-27694410 TTAAATCCCCAGGCTGGGCACGG + Intronic
1065703938 10:28453210-28453232 TTGAAATCAGAGGCTGGGCATGG - Intergenic
1066072167 10:31828859-31828881 TTTCAACATGAGGCTGGGCATGG + Intronic
1066405771 10:35116674-35116696 TTAGATGCTCTGGCTGGGCATGG + Intergenic
1066602701 10:37125369-37125391 CCGGACCCTGATGCTGGGCACGG - Intergenic
1067001737 10:42621033-42621055 TTTTAGACTGAGGCTGGGCATGG + Intronic
1067037338 10:42930378-42930400 GAGGATCCAGAGGCTGGGGATGG + Intergenic
1067236723 10:44457282-44457304 GTGGATTCTAGGGCTGGGCAGGG + Intergenic
1067656619 10:48197199-48197221 TTGGGTCCTGGGGCTGGCCCAGG - Intronic
1068887952 10:62116697-62116719 TAGTATTCTGAGGCCGGGCACGG - Intergenic
1069039391 10:63679240-63679262 GTCGATGATGAGGCTGGGCATGG + Intergenic
1069506964 10:69008131-69008153 TTAAATCCTCAGGCTGGGCAAGG + Intronic
1069667052 10:70170006-70170028 TCGGAGACTGAGGCTGGCCAAGG - Intronic
1069697678 10:70398918-70398940 TTCTCACCTGAGGCTGGGCATGG + Intergenic
1069710198 10:70483126-70483148 TTGGAGCCTGAGGGAGGGAATGG + Intronic
1069742822 10:70696335-70696357 TTGGAGTATGAGACTGGGCAGGG + Intronic
1069837875 10:71320416-71320438 ATGGATCTGGAGGCTGGGAAGGG + Intronic
1069930375 10:71877779-71877801 CTGGATTGTGAGGATGGGCAGGG - Intergenic
1070349974 10:75582501-75582523 CAGTGTCCTGAGGCTGGGCAGGG + Intronic
1070372084 10:75792140-75792162 TAAGATCCTGGGGCCGGGCAAGG - Intronic
1070592185 10:77809114-77809136 ATCAATCCTGAGGCTGGACACGG + Intronic
1070676783 10:78417453-78417475 TTGGATCATGTGGCAGGCCATGG - Intergenic
1070688705 10:78509146-78509168 TTGGCTCTTGATGCTGGGAAAGG - Intergenic
1070961883 10:80505244-80505266 TCTCCTCCTGAGGCTGGGCAAGG - Intronic
1071184195 10:83021673-83021695 TTGAATTCTGAGGCTGAGTAAGG - Intergenic
1071456656 10:85856384-85856406 CTAGTTCCTGAGGCAGGGCAAGG - Intronic
1071698936 10:87908425-87908447 TTGTATACTCTGGCTGGGCACGG + Intronic
1072212331 10:93257897-93257919 AAGAAACCTGAGGCTGGGCACGG + Intergenic
1073139618 10:101238579-101238601 TGGGACCCTCTGGCTGGGCAAGG + Intergenic
1073496219 10:103893456-103893478 ATGGATCTGTAGGCTGGGCACGG - Intronic
1073502254 10:103951018-103951040 TAGGATCCCAAGGCTGGGCATGG - Intergenic
1074087292 10:110218158-110218180 TGGAATCTGGAGGCTGGGCACGG + Intronic
1074540167 10:114358622-114358644 ATAGAGCCTTAGGCTGGGCACGG + Intronic
1075692462 10:124407242-124407264 GAGGTTCCTGAGGCTAGGCAGGG - Intronic
1076022054 10:127082107-127082129 TTGGCGCCTCAGGCTGGGGAAGG + Intronic
1076401507 10:130188554-130188576 TTGGCTCCTGTGGCTTGGGAGGG + Intergenic
1076485048 10:130810443-130810465 TGGGACACTGACGCTGGGCAGGG - Intergenic
1077070169 11:666430-666452 GCAGATCCTGAGGCTGGGCACGG + Intronic
1077375592 11:2203906-2203928 TGGGATCCTGGGGCTGGGCTGGG + Intergenic
1077443336 11:2578762-2578784 TGGGCTCTCGAGGCTGGGCAAGG + Intronic
1077974695 11:7235619-7235641 TTGGTTTCTGAGGTTGGGCTGGG + Intergenic
1078280714 11:9898378-9898400 ATGGATTATAAGGCTGGGCACGG + Intronic
1078526028 11:12102167-12102189 TTGCTTCCTACGGCTGGGCACGG + Intronic
1078788886 11:14523871-14523893 ATGTATCTTGAGGCCGGGCATGG - Intronic
1079133874 11:17765078-17765100 GAGGATTCTGAGGCAGGGCAGGG - Intronic
1080192783 11:29571253-29571275 TAGTGTCCTGAGGCTGTGCAGGG + Intergenic
1080539201 11:33250457-33250479 TTGGATGTTCAGGCTGGGCGTGG + Intergenic
1081505963 11:43717509-43717531 GTGGATCCGGAGTTTGGGCAGGG + Intronic
1081744630 11:45464278-45464300 CTGGCTCCTGTGGCTGGGCCAGG - Intergenic
1081933839 11:46890882-46890904 AAGCATTCTGAGGCTGGGCATGG - Intronic
1083485841 11:62982515-62982537 TTGGATACTTAGGCTGGACTTGG + Intronic
1083553748 11:63609769-63609791 TGGGCTGCTGAGGCTGGGCCTGG - Intronic
1083864157 11:65444652-65444674 GTGGATCCTGAGGGTGGCCTGGG + Intergenic
1084235904 11:67787963-67787985 CTGGAGGCTGTGGCTGGGCAGGG + Intergenic
1084325134 11:68395912-68395934 TTTGCTCCTGGCGCTGGGCAAGG - Intronic
1084394305 11:68898753-68898775 TGGCATCCTGAGGGTGGGGAGGG - Intronic
1084439050 11:69160476-69160498 CAGGATTCTGAGGCCGGGCATGG - Intergenic
1085254025 11:75162235-75162257 TTGGAGACTGAGTCTGGGCCTGG - Intronic
1085290372 11:75394849-75394871 CTGAATCCAAAGGCTGGGCATGG - Intergenic
1085696258 11:78707295-78707317 CTGGATCCTTTGGCTGGGCCAGG - Intronic
1085763435 11:79261604-79261626 TTGGGTCTGGAGGCTGGGCTGGG + Intronic
1087173063 11:95070076-95070098 TTGAAACCTGTGGCCGGGCATGG + Exonic
1087466090 11:98508145-98508167 GTGTTTCCTGGGGCTGGGCAAGG + Intergenic
1088006352 11:104945544-104945566 TAAGATACTGGGGCTGGGCACGG - Intronic
1088972810 11:114788354-114788376 GTGGAGCCTCAGGCTGGACATGG + Intergenic
1090495001 11:127202937-127202959 TTGTATATTGCGGCTGGGCATGG - Intergenic
1090621671 11:128566249-128566271 GTGGATACTGGGGCTGGGAAGGG - Intronic
1090945908 11:131429345-131429367 TAGAACCCTGAGGCTGGGCGGGG - Intronic
1091349420 11:134881140-134881162 TTGGATGCTGAGGATGAGGATGG + Intergenic
1091548230 12:1518698-1518720 TTGGATCCTGGGGCTGGGAACGG - Intergenic
1092888031 12:12942442-12942464 AGGAATTCTGAGGCTGGGCACGG + Intronic
1093177050 12:15924314-15924336 TTGGAAACTGAGGCGGGACAAGG + Intronic
1093209359 12:16289233-16289255 TTCTACCTTGAGGCTGGGCACGG - Intergenic
1094077572 12:26494477-26494499 TAGAAGCTTGAGGCTGGGCATGG + Intronic
1094722911 12:33083521-33083543 TTGAATTATGGGGCTGGGCATGG + Intergenic
1095996152 12:48086745-48086767 AAGGAGGCTGAGGCTGGGCATGG + Intronic
1096428723 12:51525683-51525705 TTGGATCGGGAGCCTGGGCGTGG + Intergenic
1096532151 12:52248936-52248958 TGGCTTCATGAGGCTGGGCAGGG + Intronic
1096987081 12:55766938-55766960 ATAGACCCTGGGGCTGGGCATGG - Intronic
1099463062 12:82947618-82947640 TTGCACTCTGAGGCTGGGCACGG - Intronic
1099602669 12:84761421-84761443 TTGGATCCCGAGCCTTGGGATGG + Intergenic
1100006268 12:89899387-89899409 CTGGAGCCTAAGGGTGGGCAGGG - Intergenic
1100705545 12:97196647-97196669 TTAGAAAGTGAGGCTGGGCATGG + Intergenic
1100847313 12:98673188-98673210 TTGGATCTTGTGGCTGGGCATGG + Intronic
1101770593 12:107746773-107746795 TTAAAACCTGGGGCTGGGCATGG - Intronic
1101812849 12:108122700-108122722 TTGGATTCTCAGGTTAGGCATGG - Intergenic
1101981905 12:109415000-109415022 TTAGATCCTTTGGCCGGGCATGG - Intronic
1102277267 12:111592096-111592118 TTAGCTCATGAGGCTGGGCGGGG + Intronic
1102989376 12:117303779-117303801 TTGAATCCTGAGTTTGTGCAGGG + Intronic
1103407757 12:120687542-120687564 CTGGATCCCGCGGCTCGGCAGGG - Intronic
1103648971 12:122418460-122418482 TTGGATAGTGGGGCTGGGCACGG + Intronic
1103839343 12:123850055-123850077 TGGGATACTGAGGCTAGGGATGG + Intronic
1105291255 13:19055180-19055202 TTGGATCCTGGCTCAGGGCAGGG + Intergenic
1105353643 13:19638322-19638344 TAAGATTTTGAGGCTGGGCACGG + Intronic
1105728277 13:23186871-23186893 TTGGATAGTGATGCTGGCCAAGG + Intronic
1105758635 13:23493062-23493084 CAGGATTCTGAGGCTGGGCGCGG - Intergenic
1106503571 13:30352478-30352500 TTTCCTCCCGAGGCTGGGCAGGG - Intergenic
1106650440 13:31684387-31684409 TTGTAGCCTGAGCATGGGCATGG - Intergenic
1106907623 13:34425109-34425131 CTGGATCCTGGGGATGGGCTGGG + Intergenic
1106923782 13:34591771-34591793 TTGGACATTCAGGCTGGGCATGG - Intergenic
1107243572 13:38265807-38265829 TAGGCTTCAGAGGCTGGGCATGG + Intergenic
1107765134 13:43726505-43726527 TTGAAACATGAGGCTGGGCGTGG - Intronic
1107797122 13:44064362-44064384 TTGGAGCCAGGGGGTGGGCAAGG + Intergenic
1108424268 13:50282704-50282726 TGGGATTCTAAGCCTGGGCATGG + Intronic
1108544712 13:51481179-51481201 TGAAAACCTGAGGCTGGGCACGG - Intergenic
1109091490 13:58052077-58052099 GAGGATGCTGAGGCTGTGCAGGG - Intergenic
1109172446 13:59113715-59113737 AAAGATTCTGAGGCTGGGCATGG + Intergenic
1109912213 13:68929081-68929103 TGGGGTTCTGAGGCTGGGCAAGG + Intergenic
1110441684 13:75533274-75533296 ATGGATATTCAGGCTGGGCACGG + Intronic
1110520476 13:76470059-76470081 ATGGATAATGAGGCCGGGCACGG - Intergenic
1112309619 13:98306812-98306834 TTGGAGCTAGAGGCCGGGCACGG - Intronic
1114046788 14:18882323-18882345 CTGGATCCTGGGGCTGAGCTGGG - Intergenic
1114054672 14:18957123-18957145 TTGGAACAGAAGGCTGGGCATGG - Intergenic
1114107884 14:19444809-19444831 TTGGAACAGAAGGCTGGGCATGG + Intergenic
1114117425 14:19637123-19637145 CTGGATCCTGGGGCTGAGCTGGG + Intergenic
1114484701 14:23055768-23055790 CTGGGTGCTGAGGCTGGGCCAGG + Exonic
1114645493 14:24253918-24253940 TTAGATAGTGAGGCAGGGCAAGG + Intronic
1116436491 14:44900118-44900140 AAAAATCCTGAGGCTGGGCACGG - Intronic
1117965089 14:61198883-61198905 TGAGATCCTCAGGCTGGGGAGGG + Intronic
1118505629 14:66407921-66407943 TTAGAAATTGAGGCTGGGCATGG - Intergenic
1119499808 14:75115405-75115427 TTGGAGTCAGAGGCTGGGCGCGG - Intronic
1119625878 14:76174923-76174945 TTTGAACTTGAGGCCGGGCACGG - Intronic
1119651734 14:76388736-76388758 TGGCCTCCAGAGGCTGGGCATGG - Intronic
1119680653 14:76590112-76590134 TTGTATTTTTAGGCTGGGCATGG - Intergenic
1119825036 14:77650570-77650592 TTGTATCTCCAGGCTGGGCATGG + Intergenic
1120026046 14:79585394-79585416 TTTGATAAAGAGGCTGGGCACGG + Intronic
1120179648 14:81330165-81330187 TGGTATGCTGAGGCTTGGCATGG - Intronic
1121452006 14:94014687-94014709 GTGAATCCTGAGACTGGCCAAGG - Intergenic
1121486887 14:94323212-94323234 TTTGCTCTGGAGGCTGGGCAGGG + Intronic
1123010547 14:105347596-105347618 TTAGAGCCTGAAGCCGGGCAGGG + Intronic
1123065667 14:105618092-105618114 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123069833 14:105637337-105637359 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123089067 14:105734125-105734147 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123094851 14:105762282-105762304 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123111014 14:105866863-105866885 ATGGAGCCTTAGGCTGGGAATGG + Intergenic
1123687438 15:22809094-22809116 TTAGTTACTGTGGCTGGGCACGG + Intronic
1123913573 15:24996984-24997006 GTGGAACCAGTGGCTGGGCATGG + Intergenic
1124354552 15:28985066-28985088 TTGGATCCTGAGGCTGAGCTTGG + Intronic
1124595778 15:31090346-31090368 CTGCATCCTGGGGCTGGGCGTGG + Intronic
1124705795 15:31963110-31963132 TTTAATGCAGAGGCTGGGCATGG - Intergenic
1125525988 15:40374983-40375005 TGGGATCTTGATGCTTGGCATGG - Intergenic
1126588693 15:50317617-50317639 TTAGATATTGAGGCTGGGCGCGG + Intronic
1128103672 15:65027486-65027508 ATGAAAACTGAGGCTGGGCACGG - Intronic
1129237035 15:74229885-74229907 GTGGATCATGAGCCAGGGCAGGG + Intergenic
1129291899 15:74574712-74574734 TATAATCCTGAGGCTGGGCGCGG + Intronic
1129297855 15:74609637-74609659 CTGTGTCCTGAGCCTGGGCAGGG + Intronic
1129330970 15:74826934-74826956 TTGGGACCTGAGGCTGGCCCGGG - Intronic
1130137615 15:81195256-81195278 TTGGATCCTGAGGCCTGGGAGGG - Intronic
1130630326 15:85561346-85561368 TTATGTCCAGAGGCTGGGCATGG - Intronic
1130910157 15:88265256-88265278 TTCCAGCATGAGGCTGGGCAAGG - Intergenic
1131074603 15:89487148-89487170 CTGAACCCTGGGGCTGGGCAAGG + Intronic
1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG + Intronic
1131261258 15:90889256-90889278 GGGGAGCCTCAGGCTGGGCAAGG - Intronic
1131360272 15:91784486-91784508 ATGGATCTTCAGGCTGGGCACGG - Intergenic
1131711487 15:95060757-95060779 AAGAATGCTGAGGCTGGGCATGG + Intergenic
1132852960 16:2033070-2033092 CTGGGTCCTGGGGCAGGGCAGGG + Intronic
1132934283 16:2473143-2473165 TTGGTGGCTGAGGCGGGGCAGGG - Intronic
1133772497 16:8875459-8875481 TAGAATCAGGAGGCTGGGCACGG - Intergenic
1133807231 16:9134894-9134916 TTGAGTCCTGAGGCTGCACATGG - Intergenic
1134130503 16:11646409-11646431 TAGCATTTTGAGGCTGGGCACGG + Intergenic
1134135445 16:11673849-11673871 GTGGCCCCTGAGGGTGGGCAGGG + Intronic
1134454632 16:14385862-14385884 TTGGACACTAAGGCTGGGCACGG - Intergenic
1134504384 16:14793096-14793118 TGGGAACCTGAGGCTTGACAAGG - Intronic
1134576189 16:15335813-15335835 TGGGAACCTGAGGCTTGACAAGG + Intergenic
1134726254 16:16420689-16420711 TGGGAACCTGAGGCTTGACAAGG - Intergenic
1134941178 16:18291171-18291193 TGGGAACCTGAGGCTTGACAAGG + Intergenic
1135238381 16:20780053-20780075 ATGTTTGCTGAGGCTGGGCATGG - Intronic
1137293673 16:47069917-47069939 TTAGATACTGAGGTTGGGGATGG - Intergenic
1137489297 16:48918332-48918354 TTGAGTCTTCAGGCTGGGCACGG - Intergenic
1137587500 16:49672524-49672546 AAGCCTCCTGAGGCTGGGCATGG + Intronic
1137618687 16:49861553-49861575 TTGGCTCCTAAGCCTGGCCATGG - Intergenic
1139400565 16:66677986-66678008 ATAGATCTTGAGGCCGGGCACGG - Intronic
1139430504 16:66908602-66908624 CAGCATCCTGAGGCTGGGCTGGG + Intronic
1139656855 16:68393112-68393134 ATGGACCAGGAGGCTGGGCATGG + Intronic
1140037218 16:71380596-71380618 TGAAATCCTGAGGCTGGGCATGG - Intronic
1140738551 16:77921172-77921194 TAGCATCATGGGGCTGGGCAAGG + Intronic
1141892411 16:86935277-86935299 GGGGATCCTGGGGCTGGGAAGGG - Intergenic
1142512839 17:408589-408611 ATGGCTGCAGAGGCTGGGCATGG - Intergenic
1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG + Intergenic
1143702094 17:8668252-8668274 TTGGTTACAGAGGCTGGGGATGG - Intergenic
1143811730 17:9477146-9477168 GAGGAACCTGAAGCTGGGCACGG - Intronic
1143969602 17:10785949-10785971 TTGGCTCCAGAGGCCGGGCGCGG - Intergenic
1144153774 17:12477900-12477922 GGAGATCATGAGGCTGGGCACGG + Intergenic
1144457227 17:15429289-15429311 GTGCAGCCTTAGGCTGGGCACGG - Intergenic
1144808290 17:17981976-17981998 TTTGGTCCTGTGGCTGGGCATGG - Intronic
1145861219 17:28211957-28211979 TGGGATGCTGAAGCTTGGCAGGG + Intergenic
1145939046 17:28732161-28732183 TTGCATTCTGGGGCTGGGCATGG + Intronic
1146032597 17:29378877-29378899 TAAGATGCTGAGGCCGGGCACGG + Intergenic
1146993511 17:37297005-37297027 TTATATGTTGAGGCTGGGCACGG - Intronic
1147047375 17:37763425-37763447 AAGGAAACTGAGGCTGGGCATGG - Intergenic
1147442897 17:40458213-40458235 TTGGATTCTGAGGTTGGGAGGGG + Intergenic
1147459658 17:40560149-40560171 TTTCTTCCTGAGGCTGAGCAGGG + Intronic
1147611379 17:41803549-41803571 TTAGATCTTGAGACTGGGGAGGG - Intronic
1147614494 17:41820157-41820179 TTGGATCCTCAGGGTCGGGAAGG + Intronic
1147752313 17:42744069-42744091 TAGGAACCTGACGCTTGGCAGGG - Intronic
1147984638 17:44298415-44298437 TGGGATCCTGAGGCCTGGTATGG - Intergenic
1148344789 17:46895909-46895931 TGGGAGCCTGGTGCTGGGCAGGG + Intergenic
1148686795 17:49505710-49505732 TTGGATCCTGAGGGTGGGGACGG - Intronic
1148762959 17:50017603-50017625 TTCCATCATGAGGCCGGGCATGG - Intergenic
1148865497 17:50626203-50626225 TTGGGTTCTGGGCCTGGGCAAGG - Exonic
1148871354 17:50660440-50660462 GAGGAGCCTGGGGCTGGGCATGG + Intronic
1148949925 17:51301814-51301836 TTGCATCATGGGGCTGGGCACGG - Intergenic
1149464603 17:56867308-56867330 TGTGCTGCTGAGGCTGGGCACGG + Exonic
1149718359 17:58817082-58817104 TGAGATTCTGAGGCTAGGCATGG - Intronic
1149878467 17:60263236-60263258 TTAGAAGTTGAGGCTGGGCATGG - Intronic
1150065190 17:62103050-62103072 TTGAATCTTAGGGCTGGGCACGG + Intergenic
1150381915 17:64727618-64727640 TTTCTTCCTGGGGCTGGGCATGG - Intergenic
1150583528 17:66497205-66497227 TGGGATCCACAGGCCGGGCACGG + Intronic
1150727168 17:67660834-67660856 GTGATTCATGAGGCTGGGCATGG - Intronic
1150737011 17:67749608-67749630 ATTGAAACTGAGGCTGGGCATGG - Intergenic
1150774344 17:68067265-68067287 TTTCTTCCTGGGGCTGGGCATGG + Intergenic
1150928082 17:69555081-69555103 ATTGAGTCTGAGGCTGGGCACGG - Intergenic
1150953327 17:69826241-69826263 TTTGATCAGGAGTCTGGGCATGG - Intergenic
1151650569 17:75466523-75466545 TTGTATTGAGAGGCTGGGCATGG + Intronic
1151720556 17:75853334-75853356 TTTGATAATTAGGCTGGGCATGG - Intronic
1151772930 17:76177031-76177053 GTGGATCCTGGGCCTGGGCCTGG - Intronic
1152047026 17:77943591-77943613 TTGCCTCCTCAGGCTGGGCGCGG - Intergenic
1152986289 18:324536-324558 TAGGATTTAGAGGCTGGGCATGG + Intronic
1153486426 18:5603421-5603443 TTGGTTCCTGTAGCTGAGCAAGG - Intronic
1153896004 18:9560925-9560947 TATAATCCTAAGGCTGGGCACGG + Intronic
1155189023 18:23413157-23413179 ATGGAGCTTGAGGCTGGGCACGG - Intronic
1155407302 18:25503047-25503069 GTGGCTACTGAGGCTGGGAAGGG + Intergenic
1155944530 18:31833711-31833733 TTGCATTCCTAGGCTGGGCACGG + Intronic
1156408682 18:36807158-36807180 TGGGCTCCTGTGGCTGGACAGGG + Intronic
1157034944 18:43960267-43960289 TAAGAGCCTGTGGCTGGGCATGG - Intergenic
1157287299 18:46385709-46385731 TTGGAGCAAGAGGCTGGGGAGGG - Intronic
1157566718 18:48683484-48683506 TTGGATCCAGAAGGAGGGCAAGG - Intronic
1158172359 18:54614136-54614158 TGGGATACTGAGGCTGACCAAGG - Intergenic
1158327423 18:56326584-56326606 TTGGATCCTCAGTCAGGGCAGGG - Intergenic
1158472567 18:57750646-57750668 TTGGACTCTGAGGATGGGTAGGG - Intronic
1158891209 18:61873622-61873644 ATGGAGACTGAGGCTGGGCGTGG - Intronic
1159598485 18:70406068-70406090 TTTGACCCTAAGGCTGGGCGCGG - Intergenic
1159939741 18:74397737-74397759 GTGGCTCCTGAGGCTGGTCGAGG + Intergenic
1160923345 19:1530906-1530928 TGGGGTCCTGAGGCTGGGCGCGG - Intronic
1160991558 19:1862432-1862454 TTGGGGCCTGAGTCTGGGCGGGG - Intronic
1161072076 19:2267563-2267585 GTTTATCCTGAGGCTGGGCACGG - Intronic
1161486981 19:4541636-4541658 TGGGCTCCGGAGACTGGGCAGGG - Intergenic
1161781351 19:6294309-6294331 TTGGCACAAGAGGCTGGGCACGG + Intergenic
1161998182 19:7727366-7727388 TCAGATCTTGAGGCTGGGCATGG - Intergenic
1162353938 19:10169118-10169140 ATGCAGCCTCAGGCTGGGCATGG - Intronic
1163502422 19:17684516-17684538 CAGGATCCTGAGGCTGTGAATGG - Intronic
1164810465 19:31150855-31150877 TTAGATTCTGAGGATGAGCAGGG - Intergenic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1165361620 19:35340568-35340590 TGGGGTCCTGAGGCCGGGCATGG - Intronic
1165424715 19:35739527-35739549 CTGGACCCTGAGCCTGGGCCAGG - Exonic
1165455718 19:35909435-35909457 CTGGAGCCTGGGGCTGGGGAAGG + Intergenic
1165465222 19:35970529-35970551 TTCCTTCGTGAGGCTGGGCATGG + Intergenic
1166698599 19:44868621-44868643 TTAAATCTTGAGGCTGGGCGTGG + Intronic
1167077932 19:47260443-47260465 TGGGACCCTGAGGATGGGGAGGG + Intronic
1167819944 19:51918484-51918506 ATTGAGCCTGAGGGTGGGCAAGG + Intronic
1168313528 19:55473513-55473535 TCAGAGTCTGAGGCTGGGCAAGG + Intergenic
1168713859 19:58516163-58516185 GGGGATCCTGAGGCTGGGTAGGG - Intronic
925078255 2:1037881-1037903 ATGAATCCTGAGGCTGTGGACGG + Intronic
925644546 2:6022435-6022457 TTGGCTTCTGGGGATGGGCATGG + Intergenic
925781353 2:7384955-7384977 TTGGAGCCTGCGGCTGGGGTGGG + Intergenic
925804107 2:7631399-7631421 GTTGACCCTAAGGCTGGGCATGG - Intergenic
926015820 2:9450443-9450465 TTTGAGCCTCAGACTGGGCACGG - Intronic
926172151 2:10559191-10559213 TGGGGTCCTGGGGCTGGGCAGGG - Intergenic
927110084 2:19858335-19858357 CTGGCTCCAAAGGCTGGGCATGG + Intergenic
927227535 2:20784113-20784135 GTGATTACTGAGGCTGGGCATGG + Intronic
927743002 2:25589660-25589682 AGGAAACCTGAGGCTGGGCATGG - Intronic
928064157 2:28146686-28146708 TTGGATCTTGAGGCTGAACTGGG + Intronic
929030994 2:37649709-37649731 CTGGTGCCTGTGGCTGGGCAAGG - Intronic
929441606 2:41969605-41969627 TTTTATTTTGAGGCTGGGCATGG - Intergenic
929467930 2:42162576-42162598 TTGCCTCTTTAGGCTGGGCACGG + Intergenic
929752886 2:44735609-44735631 TTAAAACCTGTGGCTGGGCATGG + Intronic
929913571 2:46114707-46114729 TTGGACTCTGGGGCTGGGCACGG - Intronic
929928559 2:46234648-46234670 TTGAAGTCGGAGGCTGGGCAGGG + Intergenic
930476484 2:51888718-51888740 GTGGGCTCTGAGGCTGGGCAGGG - Intergenic
930509041 2:52321656-52321678 TTGAATAATGAGGCTGGGCATGG + Intergenic
930994973 2:57705651-57705673 TTGGCTTCTGAGCTTGGGCAAGG - Intergenic
931097828 2:58961964-58961986 TTGGATATTGAGGCCTGGCATGG - Intergenic
931384542 2:61786274-61786296 TGAGAACGTGAGGCTGGGCATGG + Intergenic
931623003 2:64229903-64229925 TTGGAACCTCAGGCTGGTCCTGG + Intergenic
932000780 2:67882463-67882485 TTGGAACCCCTGGCTGGGCATGG + Intergenic
932025811 2:68131206-68131228 TTTGGACTTGAGGCTGGGCACGG - Exonic
932260056 2:70319347-70319369 TTGGATGTGGGGGCTGGGCATGG + Intergenic
932311662 2:70747298-70747320 TTGGACTCTTAGGCTGGGCATGG - Intronic
932789026 2:74636867-74636889 TGAAATCTTGAGGCTGGGCATGG - Intronic
932902540 2:75715922-75715944 TTGGATTTGGAGGCTGGGCACGG - Intergenic
933035060 2:77386045-77386067 TTGTACCATGTGGCTGGGCATGG - Intronic
933697228 2:85228723-85228745 TTTGAACCTTAGGCTGGGCTCGG + Intronic
933767884 2:85722909-85722931 ATGGCTTCTGAGGCAGGGCAGGG + Intergenic
934095129 2:88594901-88594923 AAAGAACCTGAGGCTGGGCATGG + Intronic
934553091 2:95274203-95274225 TGGGCTGCTGGGGCTGGGCATGG + Intergenic
935566887 2:104618703-104618725 TAGGAAACTCAGGCTGGGCACGG + Intergenic
935750812 2:106232359-106232381 TTGTGTTCTAAGGCTGGGCACGG - Intergenic
935939289 2:108221432-108221454 TTGGCTCCTGAGGCTGCAGAGGG - Intergenic
936075421 2:109398629-109398651 CTGGATGCAGCGGCTGGGCATGG - Exonic
936464538 2:112735332-112735354 ACTGTTCCTGAGGCTGGGCATGG - Intronic
936507445 2:113118744-113118766 TTGGCCCCTGAGGCTGGGCGTGG + Intronic
937184936 2:120031157-120031179 TTGGAGGCTGGGGCTGGGCGTGG - Intronic
937209234 2:120257440-120257462 CTGGATCCTGAGCCTGAGCCTGG + Intronic
937555682 2:123152410-123152432 TTACCTCCTGGGGCTGGGCATGG - Intergenic
937686748 2:124706454-124706476 GTGTATCCTGAGGCTGGGCATGG + Intronic
938470651 2:131557200-131557222 TTGGAACAGAAGGCTGGGCATGG - Intergenic
938472680 2:131579976-131579998 TTGGAACAGAAGGCTGGGCACGG - Intergenic
938974108 2:136459069-136459091 TTGCATCCTGAGCCTGGAAAAGG - Intergenic
939053430 2:137333195-137333217 TCGGAACCTGCTGCTGGGCAGGG - Intronic
939565834 2:143785430-143785452 ATGAATCCTGAGGCTGGGTGTGG + Intergenic
940092379 2:149934855-149934877 GTGGATCAGGAGCCTGGGCATGG - Intergenic
940779371 2:157916901-157916923 TTGCCTCATGGGGCTGGGCATGG + Intronic
941363337 2:164580381-164580403 ATGTATCATAAGGCTGGGCATGG - Intronic
943499543 2:188669942-188669964 TTGGTTACTGAGTCTGGCCAGGG - Intergenic
943876147 2:193070817-193070839 TAGTATCCTGAGGCTGTGCAGGG - Intergenic
944031620 2:195241323-195241345 TAGCATTCTTAGGCTGGGCACGG + Intergenic
944981277 2:205123468-205123490 TTGGATCCAGGAGCTGGCCAAGG + Intronic
947176178 2:227369705-227369727 TGGGAACATTAGGCTGGGCACGG - Intronic
947466060 2:230347574-230347596 CTGGCCACTGAGGCTGGGCAGGG + Intronic
947510055 2:230744207-230744229 ATGTATCATGGGGCTGGGCACGG - Intronic
947612275 2:231531482-231531504 TTGTCTCCTTAGCCTGGGCAAGG + Intergenic
947977825 2:234382781-234382803 TGGGAGCCTGAGGCCAGGCACGG + Intergenic
947994756 2:234517656-234517678 TTGAGTGCTGAGGCTGGGCCAGG - Intergenic
948791083 2:240377122-240377144 TTGAATCCTGATGCTGGCCCGGG - Intergenic
948869623 2:240791621-240791643 TTGGCACCTAGGGCTGGGCAAGG - Intronic
1168773568 20:431137-431159 CTTGCCCCTGAGGCTGGGCATGG - Intergenic
1168809431 20:694571-694593 TTGGTTCCTGAGGAAGGGGAGGG + Intergenic
1169315030 20:4583307-4583329 TTCCATCCTTAGGCTAGGCAGGG + Intergenic
1169340625 20:4793768-4793790 AAGGATCCTGAGGCTGTGCGTGG - Intronic
1169448637 20:5692734-5692756 TTTAATCCTGTGGCTGGGCATGG - Intergenic
1169462859 20:5811562-5811584 TGGAGACCTGAGGCTGGGCATGG + Intronic
1171210998 20:23316830-23316852 TTGGATGTTGAGGCAGGGCTGGG + Intergenic
1172162419 20:32877962-32877984 TTGAATCCTGAGTATGGGAAGGG - Intronic
1172801673 20:37580520-37580542 TGAGATGCTGAGGCTGGTCAAGG + Intergenic
1173029440 20:39341236-39341258 TTGGATCCTAAAGCTATGCAAGG - Intergenic
1173333744 20:42096864-42096886 ATGGGTCTAGAGGCTGGGCATGG - Intronic
1173342035 20:42161496-42161518 CTGGATCGTGAGGGTGGGCTGGG + Exonic
1173399293 20:42710382-42710404 CAGTGTCCTGAGGCTGGGCAGGG - Intronic
1173610267 20:44362115-44362137 AAGCATGCTGAGGCTGGGCATGG + Intronic
1174204875 20:48831006-48831028 TTGGTTCCTGAGGCTGGTGTAGG + Intergenic
1174347716 20:49943204-49943226 TTCACTCTTGAGGCTGGGCATGG + Intronic
1174505704 20:51016144-51016166 TGGGATGCTGAGGCCAGGCATGG + Intronic
1175818633 20:61896600-61896622 TTGCATCCTGGGGCTGCGCCCGG - Intronic
1175983432 20:62752749-62752771 TTATCTCCTGAGGCTGGGCCTGG + Intronic
1176179053 20:63741094-63741116 TCAGATACTGGGGCTGGGCAGGG - Intronic
1176300818 21:5098183-5098205 CTGGAGCCTGGGGCGGGGCAGGG - Intergenic
1177295887 21:19175318-19175340 TATGATCCTAGGGCTGGGCACGG + Intergenic
1177773663 21:25544713-25544735 TAGCATCCTGAGGCTGAGCAGGG + Intergenic
1178127636 21:29532625-29532647 TTTGATGCTGTGGCGGGGCAGGG + Intronic
1178285042 21:31318393-31318415 TTTTATCCTGTGGCTGGGCACGG - Intronic
1178538362 21:33428917-33428939 TTGTATCCTAGAGCTGGGCAGGG + Intronic
1178793497 21:35722107-35722129 GTGGTTCCTGAGGAGGGGCAGGG - Intronic
1178815312 21:35924021-35924043 TTGCACGATGAGGCTGGGCAAGG - Intronic
1179251213 21:39673309-39673331 GTGGATCCTGAAGGTGGGCGGGG + Intergenic
1179334582 21:40438546-40438568 TTGGACCTTGAGGTTGGCCAAGG - Intronic
1179856217 21:44163770-44163792 CTGGAGCCTGGGGCGGGGCAGGG + Intergenic
1180404409 22:12537275-12537297 TTCATTCCTGGGGCTGGGCATGG - Intergenic
1180465324 22:15604962-15604984 CTGGATCCTGGGGCTGAGCTGGG - Intergenic
1180473141 22:15679515-15679537 TTGGAACAGAAGGCTGGGCATGG - Intergenic
1180695221 22:17747609-17747631 GTGGATCTAGAGGCTGGGCATGG - Intronic
1180743960 22:18074245-18074267 TTGGATTCCAGGGCTGGGCACGG + Intergenic
1180800220 22:18628267-18628289 CTGCGTCCTGAGGCTGAGCAGGG + Intergenic
1180851453 22:19023831-19023853 CTGCGTCCTGAGGCTGAGCAGGG + Intergenic
1181221496 22:21366999-21367021 CTGCGTCCTGAGGCTGAGCAGGG - Intergenic
1181630608 22:24149219-24149241 TTGGAGCCTGAGGCTGGCTGGGG - Intronic
1182201127 22:28571655-28571677 ATGTATACTCAGGCTGGGCACGG + Intronic
1182518461 22:30871954-30871976 CTGGGGCCTGAGGCTGGGCGAGG + Intronic
1183068103 22:35377586-35377608 ATGGAGGATGAGGCTGGGCACGG - Intergenic
1183218916 22:36499323-36499345 TTTGATGCTCAGGCTAGGCATGG + Intronic
1183490326 22:38112336-38112358 TAGGATGCTCAGGCTGGGCAGGG + Intronic
1183598555 22:38826741-38826763 GAGGACCCTGAGGGTGGGCAAGG + Exonic
1183599918 22:38833940-38833962 TTGGTTCTTGAGCCTGGGCAGGG + Intronic
1184292023 22:43502471-43502493 CTGAAGCCTGAGGCAGGGCAGGG + Intronic
1184414924 22:44346732-44346754 TTGCATTCTGGGGCTGGCCACGG - Intergenic
1184577136 22:45379278-45379300 CTGAATGTTGAGGCTGGGCATGG - Intronic
1185052650 22:48561952-48561974 AGGGAGCCTGAGGCCGGGCAGGG - Intronic
1185407490 22:50662224-50662246 TTAGAAAATGAGGCTGGGCACGG + Intergenic
949811477 3:8011494-8011516 CTGGATCAGGAGTCTGGGCATGG + Intergenic
950032099 3:9860084-9860106 TTGGGTGCCAAGGCTGGGCAGGG + Intergenic
950158808 3:10743641-10743663 AGGGAGACTGAGGCTGGGCAGGG + Intergenic
952348331 3:32509678-32509700 TTGGATCTGGAGGCTGGGCGCGG + Intergenic
953499198 3:43416775-43416797 TTGGATTAAGAGGCTGGGAATGG - Intronic
953554393 3:43931955-43931977 TTGCATTATGGGGCTGGGCACGG + Intergenic
953790301 3:45942377-45942399 CTGGATCCTGAGGCTGCTCCTGG + Intronic
953885841 3:46713973-46713995 TTGAATCCTGAGTCAGGCCAGGG - Intronic
953971712 3:47353340-47353362 ATAAATCGTGAGGCTGGGCACGG - Intergenic
953993466 3:47501712-47501734 TGTGCTCCTGAGCCTGGGCATGG - Exonic
954424045 3:50434058-50434080 TGTGATCCTGAGGCTGGGACTGG - Intronic
954479460 3:50784864-50784886 TTGCATCCTGTGGCCAGGCACGG + Intronic
954891344 3:53932652-53932674 GTAAATTCTGAGGCTGGGCACGG + Intergenic
955736830 3:62047550-62047572 TAGGAAGCTGGGGCTGGGCATGG - Intronic
956465901 3:69520542-69520564 TTCTATCCTGGGGCTTGGCATGG + Intronic
956796156 3:72720492-72720514 TTAGATCCTGTGGCTGCCCAGGG + Intergenic
957716631 3:83936603-83936625 CTGCATCCTGAGGCAGTGCAGGG - Intergenic
959711298 3:109388439-109388461 TAAGATCATGAGGCTAGGCAGGG - Intergenic
959826414 3:110802517-110802539 TGGGATCCAGACCCTGGGCATGG - Intergenic
960848766 3:122030154-122030176 TTAGATTCTTAGGCTGTGCATGG - Intergenic
961447456 3:126987584-126987606 TGGGGTGCTGAGGCTGGGAAGGG + Intergenic
961622009 3:128231659-128231681 TTGGATCCTGGGGCAGGGTTGGG - Intronic
961784850 3:129341521-129341543 TTGGGTGCCAAGGCTGGGCAGGG + Intergenic
962225466 3:133603184-133603206 TTACTTCCTGAGGCCGGGCATGG - Intronic
963316736 3:143766862-143766884 TTGCAGTCTAAGGCTGGGCATGG - Intronic
964338837 3:155686633-155686655 GAGGATGCTGAGGCTGGGAAAGG - Intronic
965202813 3:165681696-165681718 TTGGTTCCTGTGGCTGGCTAGGG - Intergenic
965507947 3:169536706-169536728 TTGAAGCATGAGGTTGGGCAAGG - Intronic
966175000 3:177128662-177128684 TTGGTGGCTCAGGCTGGGCACGG - Intronic
966188530 3:177249535-177249557 ACGGATGCTGAGGCTGGGCTGGG + Intergenic
966296689 3:178432279-178432301 TTGGATCATGGGGTGGGGCACGG + Intronic
967072329 3:185972836-185972858 AGTCATCCTGAGGCTGGGCATGG - Intergenic
967904782 3:194490853-194490875 CTGTAAACTGAGGCTGGGCATGG + Intronic
968233957 3:197020954-197020976 TTTGGTGTTGAGGCTGGGCACGG - Intronic
968255198 3:197263494-197263516 ATGTCTCATGAGGCTGGGCATGG + Intronic
968259351 3:197307248-197307270 TTTCAACCTGAGGCTGGACATGG + Intergenic
968394938 4:226930-226952 ATGCATCCTTAGGCCGGGCACGG + Intergenic
968557529 4:1254273-1254295 TTCGATACCTAGGCTGGGCACGG - Intergenic
968690275 4:1986630-1986652 TGAGATCCTGTGGCTGGGCTGGG - Intronic
969361535 4:6667157-6667179 ATGGTTTCTGAGGCTGGGCGCGG - Intergenic
970263164 4:14251057-14251079 TTGGATTATGAGACTGGCCATGG - Intergenic
970555694 4:17230169-17230191 TATGATTCTTAGGCTGGGCACGG + Intergenic
971491254 4:27214551-27214573 TTGAAAACTGAGGCAGGGCATGG + Intergenic
971494138 4:27246324-27246346 AAGGATCTTAAGGCTGGGCATGG + Intergenic
971542198 4:27833237-27833259 TAGGATGTTAAGGCTGGGCACGG + Intergenic
972420020 4:38878282-38878304 TGGCATCCTGAGGCTGCACAGGG - Exonic
972492415 4:39600327-39600349 CTGGATGATTAGGCTGGGCACGG - Intronic
974873622 4:67675438-67675460 TTGGAGGTTTAGGCTGGGCACGG + Intronic
975133601 4:70852087-70852109 ACAGATCATGAGGCTGGGCATGG - Intergenic
975357392 4:73424144-73424166 TTGGTGCCTGAGACTGGTCAGGG - Intergenic
977541075 4:98319488-98319510 TTGGGTTTTGTGGCTGGGCATGG + Intronic
978561349 4:110037057-110037079 ATGGATGCAAAGGCTGGGCATGG + Intergenic
978801579 4:112760475-112760497 ATGGAATTTGAGGCTGGGCACGG - Intergenic
980401163 4:132287870-132287892 TAACATTCTGAGGCTGGGCATGG + Intergenic
981527331 4:145719926-145719948 TTGTGGCCTGAGGCTGGGGAAGG + Intronic
981556082 4:145996214-145996236 GTGGTTACTGAGGCTGGGAAGGG - Intergenic
981658341 4:147137545-147137567 TTAGATTGTGAGGCTGGGAAAGG - Intergenic
981690970 4:147508427-147508449 TTTGCTCTTCAGGCTGGGCATGG - Intronic
982028390 4:151275375-151275397 ATGTATCTTGAGGCTGGGCATGG - Intronic
982255144 4:153444228-153444250 AGGGATGTTGAGGCTGGGCAAGG - Intergenic
984791112 4:183615937-183615959 TGGAATATTGAGGCTGGGCACGG - Intergenic
985534710 5:457536-457558 GTGGTTGCTGAGTCTGGGCATGG + Intronic
985768871 5:1796599-1796621 GAGGGGCCTGAGGCTGGGCACGG - Intergenic
986646626 5:9922580-9922602 TTGGTGCCTCAGGCTGGCCAGGG - Intergenic
987496246 5:18648609-18648631 TTGAATCATGGGGCTGGGGAGGG + Intergenic
988665451 5:33322340-33322362 CTAGAACCTGGGGCTGGGCATGG - Intergenic
990758331 5:59101047-59101069 TTGGAGTCCAAGGCTGGGCATGG - Intronic
990898930 5:60729242-60729264 TGGGATGCTGAAGTTGGGCAGGG + Intergenic
991293403 5:65055651-65055673 TTAGGAACTGAGGCTGGGCACGG - Intergenic
991591078 5:68251939-68251961 TTGGATCATGAGTTTGGGCTTGG + Intronic
991733815 5:69613634-69613656 ATAGAATCTGAGGCTGGGCACGG - Intergenic
991810249 5:70468776-70468798 ATAGAATCTGAGGCTGGGCACGG - Intergenic
991860452 5:71008512-71008534 ATAGAATCTGAGGCTGGGCACGG + Intronic
992603055 5:78424437-78424459 TTGTAACTTGGGGCTGGGCATGG + Intronic
992798729 5:80276578-80276600 TTAGACTTTGAGGCTGGGCACGG + Intergenic
993253299 5:85555965-85555987 TTGTTACCTGAGGCTGGGAAGGG + Intergenic
994514461 5:100753120-100753142 TTGGAACCTCAGCCTGGTCAAGG - Intergenic
994699360 5:103113810-103113832 TTGGACCTTGGGGCTGGGCGCGG - Intronic
995061357 5:107814516-107814538 TTGAGTCCTGAGGCTGGGGAGGG + Intergenic
995195339 5:109360835-109360857 TTATATTCAGAGGCTGGGCATGG + Intronic
995392804 5:111657463-111657485 TTTGATCCTGCGGCTGGGCGTGG - Intergenic
995593326 5:113722697-113722719 TTTGCTGCTGAGGCTGGACATGG + Intergenic
995751075 5:115453806-115453828 AGGTGTCCTGAGGCTGGGCAGGG - Intergenic
995877669 5:116807652-116807674 TTGGATACCTATGCTGGGCACGG - Intergenic
996073450 5:119161380-119161402 TTGGGTTCTGAAGTTGGGCAGGG + Intronic
996625532 5:125566286-125566308 GTGCATCATGAGGCTGGGCGTGG + Intergenic
997119651 5:131161311-131161333 TTGTATTCTGGGGCTGGGCGTGG + Intronic
997406329 5:133650234-133650256 TTGGTTCCTGATGTTGGGGATGG - Intergenic
997822185 5:137076086-137076108 TTGCATGGTGAGGCTGTGCATGG - Intronic
998092637 5:139380163-139380185 TAGGGTGCTGGGGCTGGGCAGGG + Intronic
998151081 5:139757883-139757905 TGGTTTCTTGAGGCTGGGCACGG + Intergenic
999228383 5:150046520-150046542 TTAGATATTGAGGCTGGGCACGG + Intronic
999730624 5:154474464-154474486 ACGGAGCCTGAGGCTGTGCAGGG - Intergenic
1000748587 5:165066485-165066507 TTCAAAACTGAGGCTGGGCACGG - Intergenic
1001098714 5:168796458-168796480 TGAGATCCTGAGCCTGGGCCAGG - Intronic
1001866487 5:175110435-175110457 TAAGAAGCTGAGGCTGGGCATGG - Intergenic
1001879907 5:175234361-175234383 TAGGATCCTGAAGGTGGGAAGGG - Intergenic
1002656413 5:180751742-180751764 TTAGAAACTCAGGCTGGGCATGG - Intergenic
1002879688 6:1239985-1240007 TTGGAGCCAGAGACTGCGCAGGG - Intergenic
1003115062 6:3278095-3278117 ATGGCTCCAGAGTCTGGGCACGG - Intronic
1003187694 6:3847418-3847440 TTGGTTCATGAGGCTGAGGAAGG - Intergenic
1003981785 6:11396776-11396798 TTATACCATGAGGCTGGGCAGGG + Intergenic
1004224030 6:13769978-13770000 GTGGTTCCTAAGGCAGGGCAGGG - Intergenic
1004691096 6:17992752-17992774 TTAGATTTGGAGGCTGGGCATGG - Intergenic
1005052094 6:21694415-21694437 TTGGATCTTGAGAGTGGGGAGGG + Intergenic
1005209380 6:23443137-23443159 TTGGAAACTGAAGCTGGGCTTGG - Intergenic
1005387470 6:25299683-25299705 ATGTCTCCAGAGGCTGGGCACGG + Intronic
1005700593 6:28396892-28396914 TAGGATCATGAGGCCAGGCACGG - Intronic
1005880210 6:30051813-30051835 TAGTATCCAGAGGCTGGGAAGGG - Intergenic
1006144079 6:31947816-31947838 GTCGATGCTGAGGATGGGCACGG + Exonic
1006948226 6:37799883-37799905 TTGGTTCTTGAGGCTGAGCTGGG + Intergenic
1007361512 6:41360108-41360130 TAGTGTCCTGAGGCTGTGCAGGG - Intergenic
1007387033 6:41527217-41527239 TTGGAAGCTGAGACTGGGCAGGG - Intergenic
1008084398 6:47229040-47229062 ATGCAGCCTCAGGCTGGGCATGG + Intergenic
1011095546 6:83658067-83658089 AAGAATCTTGAGGCTGGGCATGG - Intronic
1011440096 6:87378686-87378708 TTTGATCCCCAGGCCGGGCACGG + Intronic
1011664307 6:89620140-89620162 TAGTATCCTATGGCTGGGCATGG - Intronic
1013798140 6:113908385-113908407 TTGGACCTTGAGGCCGGGCGCGG + Intergenic
1014030850 6:116702390-116702412 GTGCATACTGAGGCTGGGCATGG + Intronic
1017024479 6:150169165-150169187 TTTTATATTGAGGCTGGGCACGG - Intronic
1017557808 6:155591300-155591322 ATAGATACTGAGGCTGGGAAGGG - Intergenic
1017899661 6:158708461-158708483 TTCGAGGCTGAGGCCGGGCACGG + Intronic
1018388618 6:163326850-163326872 TTCTATCCTGAGTCTGGTCAAGG - Intergenic
1018834032 6:167470174-167470196 TAGGATCCTGAGTCAGAGCAGGG + Intergenic
1019623059 7:2002005-2002027 CTGGACCCTGGGTCTGGGCAGGG - Intronic
1019675094 7:2306398-2306420 TTTGTCCCGGAGGCTGGGCACGG - Intronic
1019929842 7:4216120-4216142 TGGCCTCCTGAGGCTGGGGAAGG + Intronic
1020029211 7:4921005-4921027 TTGACACCTGAGGCTGGGCATGG - Intronic
1020052474 7:5091032-5091054 TTGGGACCCCAGGCTGGGCATGG - Intergenic
1020174708 7:5872910-5872932 ATGGATGATGGGGCTGGGCACGG + Intergenic
1022077889 7:26991609-26991631 TTGGATCCTGAAGCCAGGCATGG + Intronic
1024053392 7:45644341-45644363 ACGGGTCCTGGGGCTGGGCAGGG + Intronic
1024506770 7:50168468-50168490 ATGGCTCCTGGGGCTAGGCAGGG - Intergenic
1024992053 7:55242659-55242681 GTGGTTACTGGGGCTGGGCAAGG - Intronic
1026015535 7:66668385-66668407 TAGGATAGTGGGGCTGGGCATGG - Intronic
1026571988 7:71539222-71539244 GAGTATCCTGAGGCTGGGCACGG - Intronic
1026901899 7:74042028-74042050 TGGGGTCTTGTGGCTGGGCACGG - Intronic
1027214432 7:76174675-76174697 GTGGAAAATGAGGCTGGGCAGGG - Intergenic
1027244079 7:76354218-76354240 GTGGTCCTTGAGGCTGGGCACGG + Intronic
1028408890 7:90506470-90506492 TTGTATTCTTAGGCTGGGCTTGG + Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028824225 7:95250990-95251012 TTAGCTTCTGAGGCTTGGCATGG - Intronic
1028993173 7:97072388-97072410 TTCCATCTTGAGGCTGGGCATGG + Intergenic
1029594433 7:101529547-101529569 TTGGGTGATGAGGCCGGGCATGG - Intronic
1029614040 7:101645214-101645236 TGGGATCCTGTGCCCGGGCAGGG - Intergenic
1029728054 7:102421251-102421273 TTGAAAAATGAGGCTGGGCACGG + Intronic
1029747268 7:102523117-102523139 GGGGATGGTGAGGCTGGGCATGG - Intergenic
1029765221 7:102622207-102622229 GGGGATGGTGAGGCTGGGCATGG - Intronic
1030065246 7:105654401-105654423 GTGGAGCCTGAGGCTGAGAAAGG + Intronic
1031826635 7:126573875-126573897 TTGGAATTTGAGGATGGGCATGG - Intronic
1032125600 7:129190188-129190210 TTGGTTACCGAGGCTGGTCAGGG + Intronic
1032198328 7:129802226-129802248 TTGACTCCAGAGGCTGGGCTGGG - Intergenic
1033082701 7:138313133-138313155 CTGATCCCTGAGGCTGGGCATGG - Intergenic
1033194477 7:139315784-139315806 ATGGAGGCTCAGGCTGGGCATGG + Intergenic
1033213989 7:139481032-139481054 AAGGCTCCTGAAGCTGGGCACGG - Intronic
1033302262 7:140196944-140196966 TTGGGTCAGGAGTCTGGGCATGG - Intergenic
1033600861 7:142887693-142887715 GTGGATGCTGAGGTAGGGCAGGG + Intergenic
1034012391 7:147543775-147543797 TGGAATCCTGAGGCTCGCCATGG - Intronic
1034319506 7:150166814-150166836 TTGGTTACAGAGGCTGGGAAAGG - Intergenic
1035191339 7:157171416-157171438 TGAGACCCTAAGGCTGGGCATGG - Intronic
1035933485 8:3810485-3810507 TTGGGACCTGGGGCTGGTCATGG + Intronic
1037031210 8:14107931-14107953 AGGGATCCTGAGGCCGGGCACGG - Intronic
1038796741 8:30716945-30716967 TTAGAGACGGAGGCTGGGCATGG + Intronic
1039161435 8:34626205-34626227 ATCCATCCTGGGGCTGGGCACGG + Intergenic
1039217340 8:35286866-35286888 TTGGAACCTGTAGTTGGGCACGG - Intronic
1039310619 8:36314348-36314370 TGAGGTCATGAGGCTGGGCATGG - Intergenic
1039440328 8:37590754-37590776 CTGGCCCCTGGGGCTGGGCAGGG + Intergenic
1039646555 8:39290518-39290540 ATGGGTGCTGAGGCTGGGCAGGG + Intergenic
1039735510 8:40328206-40328228 TTGTATGCTTTGGCTGGGCATGG + Intergenic
1040013618 8:42682514-42682536 TGGGAGGCTGAGGCTGGGCGCGG + Intergenic
1040072348 8:43198575-43198597 TAAGAACCAGAGGCTGGGCACGG - Intronic
1040106807 8:43546229-43546251 TTGGACACTGAGGCAGGCCAGGG - Intergenic
1040497797 8:47982018-47982040 TTGAATGCAGGGGCTGGGCACGG - Intergenic
1041118905 8:54566668-54566690 TTGTAACCTGAGGCTGGCCAAGG + Intergenic
1041682196 8:60605079-60605101 TAGTGTCCTGAGGCTGTGCAGGG - Intronic
1042047183 8:64666508-64666530 TTGGATCCTAAGGATGAGTAGGG + Intronic
1042295432 8:67212371-67212393 CTGGAACCTGTGGCTGGGCGTGG - Intronic
1043581969 8:81724850-81724872 CTGGTCCCTGAGGTTGGGCAGGG - Intronic
1043612626 8:82083927-82083949 ATGGTTCCAGAGGCTGGGAAGGG - Intergenic
1045021448 8:98047804-98047826 TTGAATCCTCAGGCCGGGCGCGG + Intergenic
1045315276 8:101038635-101038657 ATGACACCTGAGGCTGGGCACGG - Intergenic
1045577760 8:103444514-103444536 ATAGATCATCAGGCTGGGCATGG - Intergenic
1047425077 8:124737908-124737930 TTGGCTGCTGTGACTGGGCACGG + Intergenic
1048188176 8:132263485-132263507 TTGCCTCCTGAGGCTGGGGCTGG + Intronic
1048665521 8:136656928-136656950 ATGTAGCCTGTGGCTGGGCACGG - Intergenic
1049055504 8:140233492-140233514 TTAGTCCTTGAGGCTGGGCACGG - Intronic
1049532042 8:143159753-143159775 TTGCATCCTGAGGCTGGGAAAGG - Intronic
1049722150 8:144123369-144123391 GAGGATACTGAGGCTGGGAAGGG + Intergenic
1049820929 8:144632730-144632752 CCTGAGCCTGAGGCTGGGCAGGG + Intergenic
1050006960 9:1141727-1141749 ATGGGCTCTGAGGCTGGGCATGG + Intergenic
1050058827 9:1684038-1684060 CTGAATTCTGGGGCTGGGCAAGG - Intergenic
1052987668 9:34500012-34500034 TTGGGGCCTGAACCTGGGCAGGG + Intronic
1053187824 9:36033931-36033953 TTGCATATTGGGGCTGGGCATGG + Intergenic
1053519336 9:38762381-38762403 TTAGATTCTGAGACAGGGCAAGG - Intergenic
1054999586 9:71433863-71433885 TGTCATCCTGAGGCTGGGCACGG + Intronic
1055303455 9:74905368-74905390 TTGTCTTCTGAGGCTGGGCGAGG + Intergenic
1055552878 9:77447232-77447254 TTGTACATTGAGGCTGGGCATGG - Intronic
1056591018 9:87966097-87966119 AGGGAGCCTGGGGCTGGGCATGG + Intergenic
1057037672 9:91823574-91823596 TTTGTTGCTGAGGCTGGGCACGG - Intronic
1057352033 9:94307048-94307070 GTTAATCCTGAGGCCGGGCATGG + Intergenic
1057422690 9:94925277-94925299 TAGGAACTTGAGGCTGGGCGCGG - Intronic
1057655610 9:96949046-96949068 GTTAATCCTGAGGCCGGGCATGG - Intronic
1057741525 9:97716071-97716093 TTAAATCCTGAGGCTGAACATGG + Intergenic
1057811749 9:98262749-98262771 TTAAAGCCTGAGGCCGGGCATGG + Intergenic
1058222625 9:102321244-102321266 ATAAATACTGAGGCTGGGCATGG + Intergenic
1058637399 9:107049779-107049801 TTGGATCCACAGGCTGAGGAGGG + Intergenic
1058909893 9:109511428-109511450 TTTCATGCTGAGGCTGAGCATGG + Intergenic
1059404017 9:114088979-114089001 TTGGCTCCTGAGTCTATGCAGGG - Intronic
1059445013 9:114332612-114332634 CAGGATCCTGGGGCTGGGGATGG - Intronic
1059661470 9:116406072-116406094 TTGGATATAGGGGCTGGGCACGG - Intergenic
1060775604 9:126371518-126371540 TGGCTTCCTGAGGTTGGGCAGGG - Intronic
1061389524 9:130309811-130309833 TTGGCTCCTGCGGCTGCACAAGG - Intronic
1061620024 9:131805883-131805905 TGGGTTCCTGGGGCTTGGCAAGG + Intergenic
1062043567 9:134415114-134415136 GTGTATCCTGAAGCTGGGGATGG + Intronic
1062175225 9:135158315-135158337 CTGCAGCCTGAGGCTGGGAAGGG - Intergenic
1062526853 9:136981367-136981389 GTGGACCCTGGGGCTGGGAAGGG + Intronic
1185680634 X:1886099-1886121 TGAGATACTGAGGCTGAGCACGG + Intergenic
1186025377 X:5304995-5305017 TTACATCTTTAGGCTGGGCATGG - Intergenic
1186553813 X:10535930-10535952 AAGTATTCTGAGGCTGGGCATGG + Intronic
1186751470 X:12626033-12626055 TTTAATCCAAAGGCTGGGCATGG + Intronic
1187167854 X:16821698-16821720 ATGAATTCTGAGGCTGGGCGCGG + Intronic
1187226624 X:17379482-17379504 TTGTAGACTGTGGCTGGGCACGG + Intronic
1187268799 X:17761372-17761394 GAGCATCCTGAGGCTGGGGATGG - Intergenic
1187320677 X:18234954-18234976 GAGCATCCTGAGGCTGGGGATGG + Intergenic
1187787364 X:22907019-22907041 TGGTTTCCTGAGGCTGGGAAGGG - Intergenic
1189268860 X:39736392-39736414 TTGGCTCCTGAAGGTGGGCCCGG - Intergenic
1190818800 X:53953348-53953370 TGGGATCCTAGGGCTGGGCACGG + Intronic
1192625709 X:72725743-72725765 AAGAACCCTGAGGCTGGGCACGG - Intergenic
1192862143 X:75086135-75086157 TAAGTTCCTGAGGCTGGGCATGG - Intronic
1193743517 X:85245790-85245812 TTGCATAGTGAGGCTGGGAAGGG - Intronic
1194062522 X:89222135-89222157 TATGAACATGAGGCTGGGCACGG + Intergenic
1195651040 X:107285244-107285266 ATGGTTCCAGAGGCTGGGAAAGG + Intergenic
1196290753 X:113937996-113938018 ATTGATCATGTGGCTGGGCAAGG - Intergenic
1196423560 X:115546905-115546927 TAGGAGTCTCAGGCTGGGCATGG + Intergenic
1197144530 X:123156737-123156759 TAGAATTCTGAGGCTGGGCTTGG - Intergenic
1197663935 X:129202815-129202837 TTGCAAATTGAGGCTGGGCATGG - Intergenic
1198017912 X:132630654-132630676 TGTGATACTGGGGCTGGGCACGG + Intronic
1198191862 X:134315406-134315428 ATGGGATCTGAGGCTGGGCAGGG - Intergenic
1198191979 X:134316149-134316171 TTGTATCCTGAAGTTGGGCGGGG - Intergenic
1198222865 X:134618704-134618726 TGAGATGATGAGGCTGGGCATGG - Intronic
1198316019 X:135467224-135467246 ATGGTTCCTGAGGCTGGGAAGGG + Intergenic
1198589523 X:138161781-138161803 AAGGATTCTTAGGCTGGGCATGG + Intergenic
1198679977 X:139170886-139170908 TTGGAGTCTGAGGCTTGGGAAGG - Intronic
1198752573 X:139950337-139950359 TTTCATATTGAGGCTGGGCACGG + Intergenic
1200359827 X:155592896-155592918 GGGGAGTCTGAGGCTGGGCATGG - Intronic
1200762845 Y:7055778-7055800 TTGGCTCCTGATTCTGGCCATGG - Intronic