ID: 1131108625

View in Genome Browser
Species Human (GRCh38)
Location 15:89750733-89750755
Sequence GGCACAGCGGGCAGCCCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 159}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131108614_1131108625 16 Left 1131108614 15:89750694-89750716 CCTGCGTCCGTGTCTGCATCTGC 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108608_1131108625 30 Left 1131108608 15:89750680-89750702 CCCCTGCCCCTCAGCCTGCGTCC 0: 1
1: 0
2: 4
3: 76
4: 880
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108618_1131108625 9 Left 1131108618 15:89750701-89750723 CCGTGTCTGCATCTGCGCGGGGC 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108609_1131108625 29 Left 1131108609 15:89750681-89750703 CCCTGCCCCTCAGCCTGCGTCCG 0: 1
1: 0
2: 1
3: 22
4: 303
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108612_1131108625 23 Left 1131108612 15:89750687-89750709 CCCTCAGCCTGCGTCCGTGTCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108613_1131108625 22 Left 1131108613 15:89750688-89750710 CCTCAGCCTGCGTCCGTGTCTGC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108610_1131108625 28 Left 1131108610 15:89750682-89750704 CCTGCCCCTCAGCCTGCGTCCGT 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108611_1131108625 24 Left 1131108611 15:89750686-89750708 CCCCTCAGCCTGCGTCCGTGTCT 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131108625 Original CRISPR GGCACAGCGGGCAGCCCCGA GGG Exonic
901011834 1:6206598-6206620 GGCACAGCGGGCACACCAGCGGG - Exonic
901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG + Intronic
902566447 1:17314715-17314737 GGAGCAGCAGGCAGCCTCGAAGG - Intronic
903322537 1:22551643-22551665 GGCTCAGCGAGCAGCACAGAGGG - Intergenic
903514809 1:23903105-23903127 GGCACGGGTGGCAGCCCCGCGGG - Intronic
904941067 1:34165098-34165120 GGCGCGGCCGGCAGCGCCGAGGG + Exonic
906315963 1:44786568-44786590 GGCGCAGCAGGCGGCCCCGCTGG + Exonic
908128091 1:61050349-61050371 GGGCCAGCGGGCCGGCCCGAGGG - Intronic
910224564 1:84923179-84923201 GGCACAGCTGTCAGTCCTGATGG - Intergenic
910855368 1:91689703-91689725 GGCACAGCGGCCAGGACTGAAGG - Intronic
915620795 1:157082718-157082740 GGCACAGAGAGAAGCCCAGATGG + Intergenic
915932879 1:160070653-160070675 GGCCCTGCAGGCAGCGCCGAAGG + Intergenic
920071480 1:203305877-203305899 GGGACTGCGGGCCGCCCCGGGGG - Intronic
922095881 1:222442441-222442463 AGCACAGAGGGAAGCCACGAAGG + Intergenic
1063343961 10:5294304-5294326 GGCAGAGAGGGCAGCACCCAGGG + Intergenic
1066332720 10:34442456-34442478 GGCACTGAGGGGAGCCCCGGTGG + Intronic
1067745818 10:48934926-48934948 GGCACAGTGGGCATCCTCGGGGG - Intronic
1070302042 10:75210751-75210773 GGCGCGGCGGACAGCCCCGGGGG + Intronic
1072737089 10:97886390-97886412 GGCACAGCAGGCAGCAGCAACGG + Intronic
1075944491 10:126420659-126420681 GGTAAAGCAGGCAGCCCCGTTGG + Intergenic
1076188502 10:128466921-128466943 GGGACAGCGGCCAGCCTGGAGGG - Intergenic
1077010357 11:376719-376741 GGGACAGCGGGCATCCCCCCGGG + Exonic
1077094357 11:793041-793063 GGCATGGTGGGCAGCCCCGAGGG - Intronic
1079100521 11:17538796-17538818 GGCCCAGCAGCCAGCCCCCAGGG - Intronic
1083428345 11:62601203-62601225 GAAGCTGCGGGCAGCCCCGACGG - Intronic
1084974107 11:72787301-72787323 GGCCCAGAGGGCAGCTCCCAGGG - Intronic
1085275952 11:75300543-75300565 ACCACAGCGGCCAGCCCTGAAGG - Intronic
1092282338 12:7108047-7108069 GGCCCAGATGGCAGCCCCGGAGG + Intronic
1102375618 12:112419028-112419050 GTCACATCGGGCTGGCCCGAGGG - Exonic
1102783966 12:115588765-115588787 GCCCCAGCGGGCAGCCCCAGTGG - Intergenic
1103615119 12:122146935-122146957 GGCACTGTGGGCAGCCCGTAGGG - Exonic
1103937223 12:124483092-124483114 TGCACAGCAGGCAGCCCCCTGGG - Intronic
1104021312 12:124994087-124994109 GGCCGGGCGGGCAGCCCCGGAGG - Intronic
1104328550 12:127823168-127823190 GGCAGAGTGGGCAGCCAGGAGGG + Intergenic
1104986622 12:132601047-132601069 AGCCCAGCAGGCAGCCCCCAGGG - Intergenic
1105502125 13:20981802-20981824 GGAACAGCAGGCTGCCCCTATGG - Intronic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1109649936 13:65311262-65311284 GGCACAGAGGACAGCCTCCAAGG - Intergenic
1113759642 13:112838446-112838468 GGCACCGTGGTCAGCCCCGCAGG - Intronic
1114665427 14:24374779-24374801 GGCCCAGCGGGCAGCTGTGAGGG - Intronic
1122235554 14:100329065-100329087 GGCAGGGCGGGGAGCCCAGAAGG + Intronic
1122425564 14:101603335-101603357 GGAGCAGCGTGCAGCCTCGACGG + Intergenic
1122664352 14:103318329-103318351 GGCACAGTGGGCAGCCACCATGG + Intergenic
1122975243 14:105168294-105168316 GGCACACCGGGCCGCCCCTAGGG - Intronic
1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG + Exonic
1131112961 15:89776831-89776853 GGCACAGCGGGCAGCCCCAAGGG - Exonic
1132557152 16:577728-577750 GCCCCAGCGGGCAGACCCCAAGG - Intronic
1132951281 16:2563771-2563793 GGCTCTGCGGGAAGCCCAGAGGG - Intronic
1132963069 16:2636399-2636421 GGCTCTGCGGGAAGCCCAGAGGG + Intergenic
1133389236 16:5395837-5395859 GGCACTGTGGGCAGCCTCTAGGG + Intergenic
1134032450 16:11003356-11003378 GGCACAGGTGGCAGCCTCGCTGG - Intronic
1136552215 16:30987808-30987830 GGAGCAGCGGGCAACCCTGATGG + Exonic
1136605602 16:31331351-31331373 CACACAGCTGGCAGCCCCGCCGG - Intronic
1136622084 16:31436128-31436150 GGCACTGCGGGAAGGCCGGATGG + Exonic
1138340638 16:56286931-56286953 AGCACAGCTGGTAGCCCCAATGG - Intronic
1139877271 16:70156404-70156426 GGCACAGAGAGCAGCACCGTGGG - Intronic
1141436700 16:84003796-84003818 GGCACAGGTGGGAGCCCTGAGGG + Intergenic
1141516229 16:84547178-84547200 GGCCCAGCGAGGAGACCCGAGGG + Intronic
1141763347 16:86043381-86043403 CGCACAGCGGGCAGAGCCAAGGG - Intergenic
1141882448 16:86868931-86868953 AGCACAGCCTGCAGCCCTGAAGG + Intergenic
1143719300 17:8798920-8798942 GGCACAGACGGGAGCCCAGAAGG + Exonic
1143778182 17:9212981-9213003 GGCACAGGAGGCAGACCAGAGGG + Intronic
1144028943 17:11302752-11302774 GGCCAAGAGGGCAGACCCGAAGG + Intronic
1144510952 17:15876011-15876033 GGCACAGAGGGCAGCCATGATGG - Intergenic
1145122340 17:20271657-20271679 GGCATAGAGGGCAGCCATGATGG - Intronic
1145175111 17:20693701-20693723 GGCACAGAGGGCAGCCATGATGG - Intergenic
1145240309 17:21237074-21237096 GGCACAGCCTGCAGGCCCCAAGG - Intergenic
1147536350 17:41325203-41325225 GCCACAGAGGGCAGCCACGGGGG - Intergenic
1147967421 17:44200434-44200456 GAGAGAGCGGGGAGCCCCGAGGG - Intergenic
1148371053 17:47100156-47100178 GGCAGAGGAGGCGGCCCCGAGGG - Intergenic
1148835368 17:50463156-50463178 GGGACAACAGGCAGCCCCAAGGG + Exonic
1149585526 17:57783512-57783534 GGCACAGCGGGTCGCCCAGACGG + Intergenic
1150326749 17:64263548-64263570 GGGACAGTGTGCAGCCCCGTTGG - Intergenic
1151433528 17:74080605-74080627 GGCACAGGGAGGAGCCGCGATGG - Intergenic
1151452968 17:74210596-74210618 GCCACAGCGGGCAGCCCCTCTGG + Exonic
1152064727 17:78104621-78104643 AGCGCAGCGGGCAGCTCCCATGG + Exonic
1152188718 17:78875264-78875286 GGCACAGCTGGCAGACCCAAGGG + Intronic
1152223372 17:79081574-79081596 GGGGCAGCGAGCAGCCCAGATGG - Intronic
1152635673 17:81429655-81429677 GGCACAGCGGGCTGCCTGGGCGG + Intronic
1152798650 17:82321103-82321125 CGCACAGCCGGCCGCCCTGAGGG - Exonic
1155159180 18:23182011-23182033 GGCCCAGCGTGCAGCCAGGAAGG + Intronic
1157244309 18:46040078-46040100 GGAACAGAAGGCAGCCCCCAAGG + Intronic
1159988939 18:74879386-74879408 CGCACAGCAGGCAGCACCCACGG + Intronic
1160394604 18:78562720-78562742 GCCACAGCGGCCTGCCCCGACGG + Intergenic
1160416285 18:78713827-78713849 GGCACAGCAAGCTGCCCGGAAGG - Intergenic
1160691145 19:461106-461128 GGCCCAGCGCGCAGCCGCGGGGG + Intergenic
1161478739 19:4500143-4500165 CCCACAGCCAGCAGCCCCGAGGG - Intronic
1161608662 19:5229087-5229109 GCCCCAGGGGGCAGACCCGAGGG - Intronic
1165441669 19:35831738-35831760 GGCAGCAGGGGCAGCCCCGAGGG + Exonic
1166378695 19:42343555-42343577 GGTACAGCGGCCGGCCCCGTGGG + Exonic
1167000380 19:46742286-46742308 GGCAGAGAAGGCAGCCCCCAGGG - Intronic
1167311268 19:48739211-48739233 GGCCTAGCAGGCAGCCCCGGCGG - Exonic
1167399794 19:49257386-49257408 GCCACTGCGGCCAGCCACGATGG + Intergenic
1167497544 19:49828419-49828441 GGCAGAGCGGTCAGCCCCCAGGG - Intronic
1168449016 19:56448558-56448580 AGCACAGCTGGCAGCTCCAAGGG + Intronic
926120962 2:10241016-10241038 GGGCCAGCGGGCAGGGCCGAAGG - Intergenic
926766408 2:16326101-16326123 GGCACAGGGGGCATCCCAGGTGG + Intergenic
927003551 2:18824553-18824575 GGCAGAGAGGTCAGCCCCCAGGG - Intergenic
932775445 2:74525571-74525593 GGTAAAGCGAGCAGCCCAGATGG + Exonic
936147254 2:109988093-109988115 GGCACAGAGTGAAGCCCCGCAGG - Intergenic
936197438 2:110383390-110383412 GGCACAGAGTGAAGCCCCGCAGG + Intergenic
936403642 2:112184215-112184237 GACACAGAGGGGAGCCCCGCTGG + Intronic
936976185 2:118224527-118224549 GGCTCTGCGGGCCGCCCCGCCGG + Intergenic
938217015 2:129526629-129526651 GGCCCAGAGGGGAGCCCCAAAGG + Intergenic
946300478 2:218820924-218820946 GGCACAGCGGGCTGCACACAGGG + Intergenic
948461311 2:238131188-238131210 GGCTGAGCCGGCAGCCCCGCGGG + Exonic
948590952 2:239049843-239049865 GGCACGGCGGGAAGCCGCGAGGG + Exonic
948625020 2:239263428-239263450 GGCCCATGGGGCAGCTCCGAGGG - Intronic
1169216278 20:3796449-3796471 GGCACAGCTGGCTGGGCCGAGGG - Exonic
1170847591 20:19975196-19975218 GGCACAGCTGGCAGCCCAGGTGG + Exonic
1173653460 20:44682552-44682574 GGCACACCCAGCAGCCCCTAAGG + Intergenic
1173806212 20:45927042-45927064 GCCACAGCAGGCAGCCCACAGGG + Intergenic
1174419618 20:50391104-50391126 GGGACAGCAGGCTTCCCCGAGGG - Intergenic
1175419104 20:58820205-58820227 GGCTCAGCGGTCAGCACCTAAGG - Intergenic
1175698166 20:61117905-61117927 GGCATGGGGGGCAGCCCCAAAGG - Intergenic
1175964656 20:62654482-62654504 GGGACAGCAGGCAGTCCCGTGGG - Intronic
1176269169 20:64226560-64226582 GGCACAGAGAGCAGGCCTGACGG + Intronic
1176382583 21:6120660-6120682 GGCGCAGCCGGCAGCCGGGAGGG + Exonic
1179469940 21:41603673-41603695 GGAATAGTGGGCAGCCCCCAGGG + Intergenic
1179740886 21:43417579-43417601 GGCGCAGCCGGCAGCCGGGAGGG - Exonic
1179810359 21:43865650-43865672 GGCCCAGCGGGGAGGCCCGGGGG + Intronic
1180224901 21:46386509-46386531 GGCTGAGCGCCCAGCCCCGAGGG + Intronic
1180704025 22:17797838-17797860 GCCACAGCGGGCAGGCACGTCGG + Intronic
1181082092 22:20422880-20422902 GGCACTGCTGTGAGCCCCGAGGG + Intergenic
1181614211 22:24041216-24041238 GGCCCAGCTGGCAGCCCAGCGGG + Exonic
1181671639 22:24428054-24428076 GGGCCACCGGGCAGCCCCGGAGG + Intronic
1182108184 22:27704212-27704234 GGCAGAGTGGGCACCCCCCATGG - Intergenic
1183407313 22:37636663-37636685 CACACAGAGGGCAGCACCGAGGG + Intronic
1183466739 22:37983896-37983918 GGCCGCGCGCGCAGCCCCGAGGG + Intronic
1184331229 22:43829120-43829142 GGCCCAGCTGGAAGCCCTGACGG - Exonic
1184956243 22:47888537-47888559 GGTAGGGCGGGCAGCCCCGGGGG + Intergenic
1184993761 22:48187663-48187685 GGCACAGGCGGCAGACCTGAAGG - Intergenic
950224895 3:11225450-11225472 GGCACTCCAGGTAGCCCCGAGGG + Intronic
953392377 3:42541005-42541027 GGGACAGAGGGCAGCCCCCTTGG + Intergenic
954187255 3:48927111-48927133 CCCACAGCTGGCAGCCCAGAGGG - Intronic
962222339 3:133574141-133574163 GGCGCAGCGGGCAGCGCCGGCGG + Exonic
966719630 3:183049335-183049357 GCCACAGCGGGCAGCTCAAAAGG + Intronic
966886591 3:184380558-184380580 GGCGCGGCGGGCGGCCCGGAGGG + Intronic
968540980 4:1168295-1168317 CCCAGAGCGGGCAGCCCCTAAGG + Intronic
968545039 4:1194130-1194152 GGCACAGCAGGCAGTGCCTATGG + Intronic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
968653865 4:1770430-1770452 GCCACCGCGGGCAGCCCAGGCGG + Intergenic
972541228 4:40041216-40041238 GGCACAGCAGGCAGTGCCTAGGG + Intergenic
972917495 4:43898983-43899005 GGCACAGTGGCCAGGCTCGACGG - Intergenic
985579229 5:688307-688329 GGGACAGCGGGCATCCCCGTGGG + Intronic
985594072 5:780370-780392 GGGACAGCGGGCATCCCCGTGGG + Intergenic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
990724321 5:58736473-58736495 GGCAGAGCGGGCTGCTCAGAGGG - Intronic
1002419376 5:179137718-179137740 GGCTCAGCAGGCAGGCCCTAGGG - Intronic
1002645120 5:180649161-180649183 GGCTCAGCGCGCAGCCCGGCAGG + Intronic
1007406479 6:41638703-41638725 GGCTCAGCGGGCGGCGCCGGAGG - Intronic
1007415370 6:41688400-41688422 GGCACTCCGGGCAGCCACCAGGG + Intronic
1007760030 6:44128018-44128040 GGCGCAGCTGGCACCCCCGAGGG - Intronic
1017972472 6:159325326-159325348 GGCACTGCAGTCAGCCCCGCGGG + Intergenic
1019658508 7:2210691-2210713 GGAGCAGCGGGGAGCCCTGAAGG + Intronic
1022097307 7:27148868-27148890 GGCACAGAGGGCAGCTCTGCAGG + Intronic
1024317550 7:48035591-48035613 GGCGCCGCGGGCAGCACCCACGG + Exonic
1024527430 7:50360754-50360776 GGCACAGCAGGCAGTGCGGAAGG - Intronic
1026923659 7:74174290-74174312 GGCGCGGCGGACAGCCCCGGCGG + Exonic
1030110309 7:106021283-106021305 GGCACAGCAGGCAGCAGGGATGG - Intronic
1032410903 7:131692714-131692736 GGCACAGAGGACAGCCCCTCTGG - Intergenic
1034352685 7:150427726-150427748 GGCAGAGGGTGCAGCCCCCAGGG - Intergenic
1034946477 7:155265678-155265700 GGCACTGCTGGCAGCCAGGAGGG - Intergenic
1035053402 7:156017696-156017718 TGCACACCTGGCAGCCCTGACGG - Intergenic
1040105130 8:43537399-43537421 GGCACAGCTCGCAGCCCAGGAGG + Intergenic
1041105776 8:54442701-54442723 GGAACAGCGGGCACAGCCGAGGG + Intergenic
1041113352 8:54508509-54508531 AGCACAGCGGGCAGCTTCGCAGG - Intergenic
1042532652 8:69832035-69832057 GGCGAAGAGGGCTGCCCCGAAGG + Exonic
1042722919 8:71843973-71843995 GGCACAGCCGGCAGCGCGGAAGG - Exonic
1051141943 9:13987641-13987663 GGCCCAGCTGGCAGCCCTGGAGG + Intergenic
1051697966 9:19789095-19789117 CGCACAGCGCACAGCCCAGAGGG - Intergenic
1053015126 9:34657462-34657484 AACACAGCGGGCAGCCCCTAGGG - Exonic
1056780272 9:89543968-89543990 GGCACAGCAGGCAGGACTGAGGG + Intergenic
1057230371 9:93317945-93317967 GGCACAGCACTCAGCCGCGAGGG + Exonic
1059764063 9:117366685-117366707 GGCACAGTGGGCAGCCTTGGAGG - Intronic
1061700235 9:132410191-132410213 GGCACAGCCTGGAGCTCCGAAGG - Intronic
1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG + Intergenic
1062439787 9:136564530-136564552 GGCACAGCGGGCAGCACCCCAGG + Intergenic
1062578194 9:137218200-137218222 GGCACAGCGGGCAGCGCACCCGG - Intergenic
1203774532 EBV:65384-65406 GGCACAGCGGGCCGACACGCAGG + Intergenic