ID: 1131108625

View in Genome Browser
Species Human (GRCh38)
Location 15:89750733-89750755
Sequence GGCACAGCGGGCAGCCCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 159}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131108614_1131108625 16 Left 1131108614 15:89750694-89750716 CCTGCGTCCGTGTCTGCATCTGC 0: 1
1: 0
2: 2
3: 17
4: 197
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108618_1131108625 9 Left 1131108618 15:89750701-89750723 CCGTGTCTGCATCTGCGCGGGGC 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108611_1131108625 24 Left 1131108611 15:89750686-89750708 CCCCTCAGCCTGCGTCCGTGTCT 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108610_1131108625 28 Left 1131108610 15:89750682-89750704 CCTGCCCCTCAGCCTGCGTCCGT 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108613_1131108625 22 Left 1131108613 15:89750688-89750710 CCTCAGCCTGCGTCCGTGTCTGC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108608_1131108625 30 Left 1131108608 15:89750680-89750702 CCCCTGCCCCTCAGCCTGCGTCC 0: 1
1: 0
2: 4
3: 76
4: 880
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108609_1131108625 29 Left 1131108609 15:89750681-89750703 CCCTGCCCCTCAGCCTGCGTCCG 0: 1
1: 0
2: 1
3: 22
4: 303
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159
1131108612_1131108625 23 Left 1131108612 15:89750687-89750709 CCCTCAGCCTGCGTCCGTGTCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG 0: 1
1: 1
2: 0
3: 20
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131108625 Original CRISPR GGCACAGCGGGCAGCCCCGA GGG Exonic