ID: 1131110572

View in Genome Browser
Species Human (GRCh38)
Location 15:89761996-89762018
Sequence TCAGGCCAAGCGCTGGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131110572_1131110578 23 Left 1131110572 15:89761996-89762018 CCACGATCCAGCGCTTGGCCTGA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1131110578 15:89762042-89762064 TGTAGATTATGCTCCACCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1131110572_1131110580 30 Left 1131110572 15:89761996-89762018 CCACGATCCAGCGCTTGGCCTGA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1131110580 15:89762049-89762071 TATGCTCCACCCCAGGCCCTGGG 0: 1
1: 0
2: 5
3: 16
4: 230
1131110572_1131110579 29 Left 1131110572 15:89761996-89762018 CCACGATCCAGCGCTTGGCCTGA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1131110579 15:89762048-89762070 TTATGCTCCACCCCAGGCCCTGG 0: 1
1: 0
2: 1
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131110572 Original CRISPR TCAGGCCAAGCGCTGGATCG TGG (reversed) Intronic