ID: 1131112733

View in Genome Browser
Species Human (GRCh38)
Location 15:89775880-89775902
Sequence ATAAGGCATCAAGACAAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 283}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131112733_1131112741 24 Left 1131112733 15:89775880-89775902 CCGGGCTTGTCTTGATGCCTTAT 0: 1
1: 0
2: 0
3: 16
4: 283
Right 1131112741 15:89775927-89775949 CCTGGGCACAGACCTCCGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 282
1131112733_1131112736 6 Left 1131112733 15:89775880-89775902 CCGGGCTTGTCTTGATGCCTTAT 0: 1
1: 0
2: 0
3: 16
4: 283
Right 1131112736 15:89775909-89775931 CAACAGTAGGCACAGCGTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 110
1131112733_1131112739 21 Left 1131112733 15:89775880-89775902 CCGGGCTTGTCTTGATGCCTTAT 0: 1
1: 0
2: 0
3: 16
4: 283
Right 1131112739 15:89775924-89775946 CGTCCTGGGCACAGACCTCCGGG 0: 1
1: 1
2: 1
3: 15
4: 190
1131112733_1131112737 7 Left 1131112733 15:89775880-89775902 CCGGGCTTGTCTTGATGCCTTAT 0: 1
1: 0
2: 0
3: 16
4: 283
Right 1131112737 15:89775910-89775932 AACAGTAGGCACAGCGTCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1131112733_1131112738 20 Left 1131112733 15:89775880-89775902 CCGGGCTTGTCTTGATGCCTTAT 0: 1
1: 0
2: 0
3: 16
4: 283
Right 1131112738 15:89775923-89775945 GCGTCCTGGGCACAGACCTCCGG 0: 2
1: 0
2: 0
3: 13
4: 180
1131112733_1131112734 -7 Left 1131112733 15:89775880-89775902 CCGGGCTTGTCTTGATGCCTTAT 0: 1
1: 0
2: 0
3: 16
4: 283
Right 1131112734 15:89775896-89775918 GCCTTATTTAATACAACAGTAGG 0: 1
1: 0
2: 0
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131112733 Original CRISPR ATAAGGCATCAAGACAAGCC CGG (reversed) Intronic
900854873 1:5172796-5172818 AGAGGGCTTCAAGACAAGTCAGG + Intergenic
900962299 1:5932740-5932762 ATAAGTCACAAAGATAAGCCAGG + Intronic
901011078 1:6202473-6202495 ATAAGAAATTAAGAAAAGCCAGG - Intronic
903608681 1:24593808-24593830 ATAAGGAAGCAAGCCAAGCTTGG - Intronic
903706551 1:25290121-25290143 ATTTGGAATCAGGACAAGCCCGG - Intronic
903714861 1:25357847-25357869 ATCAGGAATCAAGACCATCCTGG - Intronic
903720684 1:25403233-25403255 ATTTGGAATCAGGACAAGCCCGG + Intronic
905776473 1:40670796-40670818 ATCAGGATTCAAGACTAGCCTGG - Intergenic
906382810 1:45343483-45343505 TAAAGGCATCAAAACCAGCCCGG - Exonic
909561734 1:77015734-77015756 ATAAGGCATCAAGAACAAGCAGG + Intronic
912633181 1:111267074-111267096 ATCAGGCAGCAAGGCCAGCCAGG + Intergenic
914423132 1:147548387-147548409 ATAAGGCAAAAAGACACTCCAGG - Intronic
914686984 1:149989175-149989197 ATAAAGCCTCAAAACAGGCCGGG + Intronic
914713092 1:150233053-150233075 TTAGGAGATCAAGACAAGCCTGG + Intronic
916341688 1:163744305-163744327 ACAAAGCATCAAGACCATCCAGG - Intergenic
916470561 1:165118727-165118749 ACAAGGCAACATGACAACCCAGG + Intergenic
917031396 1:170696175-170696197 ATATGGCAGTAGGACAAGCCAGG + Intronic
917999213 1:180475592-180475614 ATAAGAGTTCAAGACCAGCCTGG - Intronic
918504984 1:185244145-185244167 ATAGGGGTTCAAGACCAGCCTGG - Intronic
918579717 1:186111437-186111459 ACAAGGGTTCAAGACCAGCCTGG + Intronic
921054910 1:211536378-211536400 ACAGGAGATCAAGACAAGCCTGG + Intergenic
922223986 1:223629323-223629345 ATAAGGCATCAAGGCTCTCCTGG - Intronic
922388468 1:225113543-225113565 TTAAGGGAACAACACAAGCCTGG - Intronic
922445158 1:225690832-225690854 ATAAGACACCAAGACAAACAGGG + Intergenic
922469077 1:225864823-225864845 ATAAGGAATGAAGAGAGGCCGGG + Intronic
923223219 1:231915216-231915238 ATGAGGCACCAAGCCAATCCTGG - Intronic
923978369 1:239291326-239291348 ATAAGAGTTCGAGACAAGCCTGG - Intergenic
1063561007 10:7127634-7127656 ACCAGGAATCAAGACCAGCCTGG + Intergenic
1064297055 10:14088555-14088577 TCAAGGGGTCAAGACAAGCCTGG + Intronic
1065330136 10:24587191-24587213 CTAAGGCTTCTAGACCAGCCTGG - Intronic
1065567238 10:27025378-27025400 ACTAGGAATCAAGACCAGCCTGG - Intronic
1065871201 10:29957871-29957893 ATAAGGCAACAAGAGAGGGCAGG - Intergenic
1066343995 10:34564305-34564327 ATGATGCAACAAGACAAGGCTGG + Intronic
1066641284 10:37556706-37556728 ACAAGAGTTCAAGACAAGCCTGG - Intergenic
1067329295 10:45300243-45300265 ATAAGGTATGAAGACAAGATTGG - Intergenic
1069502726 10:68968361-68968383 GCCAGGAATCAAGACAAGCCTGG - Intronic
1070291735 10:75120985-75121007 TTAAGACTTCAAGACAAGCCTGG - Intronic
1070932622 10:80272053-80272075 TTAAGGCAACAAAAGAAGCCCGG - Exonic
1071385236 10:85113014-85113036 AAAATGCATTCAGACAAGCCTGG + Intergenic
1072198338 10:93136343-93136365 ATAAGAGTTCAAGACCAGCCTGG - Intergenic
1073061098 10:100734435-100734457 GGAAGGCACCAAGGCAAGCCAGG - Intergenic
1074301998 10:112241492-112241514 AACAGGCATCAAGACCATCCAGG - Intergenic
1074789311 10:116870429-116870451 ACAAGACTTCAAGACCAGCCTGG + Intronic
1078512577 11:11996683-11996705 AGCAGGCATCAAGACAACCTTGG + Intronic
1078992482 11:16664051-16664073 CTAAGAGTTCAAGACAAGCCTGG + Intronic
1080610897 11:33902614-33902636 ATAAGGCATCAGGAAAAACCTGG - Intergenic
1082259148 11:50064132-50064154 TTAGGAGATCAAGACAAGCCTGG - Intergenic
1082954724 11:58857610-58857632 ATAAGACATCAACACAACCTGGG - Intronic
1082971782 11:59030307-59030329 ATAAGACATCAACACAACCTAGG - Intronic
1085668799 11:78441499-78441521 ATCAGGATTCCAGACAAGCCTGG + Intronic
1086325864 11:85698746-85698768 TTAAGAGTTCAAGACAAGCCTGG - Intronic
1086748904 11:90465614-90465636 GTCAGGAATCAAGACCAGCCTGG + Intergenic
1087083631 11:94195644-94195666 ATAAGACCTCAAGACGAGCAAGG - Intergenic
1087567728 11:99883653-99883675 ATAGGTTATCAAGACAGGCCAGG - Intronic
1087754854 11:102044491-102044513 ACCAGGAATCAAGACCAGCCTGG - Intergenic
1087978988 11:104587343-104587365 ATGAGCCATCAAGCCCAGCCTGG - Intergenic
1088555593 11:111057432-111057454 ATAAAGCCTCAAGTCAGGCCGGG + Intergenic
1088697871 11:112383800-112383822 ATAAGGCATGCAGACAAAACTGG + Intergenic
1089893789 11:121907273-121907295 ATAAGACATGAAGACAAGAGTGG + Intergenic
1092300014 12:7238834-7238856 CCAGGGCATCAAGACTAGCCCGG + Intergenic
1092878959 12:12873007-12873029 ATACGGAATCAGAACAAGCCTGG - Intergenic
1092949851 12:13491470-13491492 ATAAGGCATCAAAGAAATCCTGG + Intergenic
1093451215 12:19317082-19317104 ATAAGCCACCTCGACAAGCCTGG - Intronic
1093653558 12:21671257-21671279 AAAAGGCATCTAAACAAGTCTGG - Intronic
1097351199 12:58550828-58550850 ATAAGACAATAAGACAAGCCAGG - Intronic
1097360891 12:58656599-58656621 ATCAGGCACCAGGAGAAGCCAGG + Intronic
1097421991 12:59391424-59391446 ATAAGGCATGCAGACAAGATTGG + Intergenic
1099550890 12:84042472-84042494 ATAAAGCATGAAGACAAGTTTGG - Intergenic
1099721833 12:86372204-86372226 ATATGACATCAAGACACTCCAGG + Intronic
1101473058 12:105017287-105017309 GTCAGGAATCCAGACAAGCCTGG + Intronic
1102127026 12:110491980-110492002 AAAAATCATCAAGACAGGCCTGG + Exonic
1104324538 12:127783900-127783922 TCAGGGCATCAAGACCAGCCTGG - Intergenic
1105797343 13:23868454-23868476 AGAAGGAATAAAGACAAGCGAGG + Intronic
1108809382 13:54202571-54202593 ATAGGAGTTCAAGACAAGCCTGG - Intergenic
1110254117 13:73413024-73413046 ATAAGAGTTCAAGACCAGCCTGG - Intergenic
1112238747 13:97660309-97660331 AAAATGCATCAAGAGAACCCTGG + Intergenic
1114190069 14:20434324-20434346 TTAAGAGTTCAAGACAAGCCTGG + Intronic
1115140360 14:30163936-30163958 CCAAGGGATCAAGACCAGCCTGG + Intronic
1115621273 14:35142888-35142910 TCAGGGCATCAAGACCAGCCTGG - Intronic
1115720169 14:36152292-36152314 AAAAGACATCAAGAAAAGCCAGG + Intergenic
1115848667 14:37568744-37568766 GTAAGGCATCAAGACGAACAGGG - Intergenic
1118443763 14:65834150-65834172 AAAAGGTAACAAGACCAGCCTGG - Intergenic
1119282464 14:73421392-73421414 CTGAGGCTTCAAGACCAGCCTGG - Intronic
1120810041 14:88793300-88793322 ATAAGGCAGCAAGACACACAAGG - Intergenic
1123784883 15:23661606-23661628 CTAAGGCTACAGGACAAGCCAGG - Intergenic
1125418745 15:39480991-39481013 ATAAGAGATCAAGGCAAGCATGG + Intergenic
1127089137 15:55449283-55449305 TTAAGACATAATGACAAGCCGGG - Intronic
1127876730 15:63118295-63118317 TTAAGAGATCAAGACCAGCCTGG - Intergenic
1128039936 15:64563238-64563260 CTAAGAGTTCAAGACAAGCCTGG + Intronic
1128553045 15:68610434-68610456 ATCAGGGAGGAAGACAAGCCTGG - Intronic
1129389644 15:75214150-75214172 ATGAGGCCTCAGGACAAGCAGGG - Intergenic
1129443718 15:75601363-75601385 TCAAGAAATCAAGACAAGCCTGG + Intronic
1131112733 15:89775880-89775902 ATAAGGCATCAAGACAAGCCCGG - Intronic
1131310383 15:91285338-91285360 ATAGGGCCTCAAGACTACCCAGG - Intronic
1131694917 15:94866239-94866261 ATAAAAAATCAAGACTAGCCAGG - Intergenic
1132417665 15:101634947-101634969 CCAAGGGTTCAAGACAAGCCTGG + Intronic
1134032435 16:11003274-11003296 AAAAGGCATCAAGACGAGTGGGG + Exonic
1134759452 16:16701076-16701098 ATAAAGCTTCAAGACAACTCAGG - Intergenic
1134986618 16:18658118-18658140 ATAAAGCTTCAAGACAACTCAGG + Intergenic
1137527771 16:49251103-49251125 ATGAGGCACCAAGATGAGCCTGG - Intergenic
1138317413 16:56082008-56082030 ATAAGCAGTCAAGAGAAGCCAGG + Intergenic
1138649578 16:58451666-58451688 ATAATGCACCAGGACAAGACGGG + Intergenic
1139440013 16:66961857-66961879 TTAAGACATAAAGACAGGCCAGG - Intronic
1139956581 16:70696127-70696149 AGAAGGCAACATGACCAGCCAGG - Intronic
1140111823 16:72011427-72011449 CTAAGGGTTCAAGACCAGCCTGG + Intronic
1141169465 16:81681991-81682013 TTGAGGCCTCAAGACCAGCCTGG + Intronic
1141337375 16:83169384-83169406 TCAAGACATCAAGACAATCCTGG - Intronic
1142366245 16:89651472-89651494 AAAAGGCATCAAAACAAAACAGG + Intronic
1143737956 17:8927096-8927118 ATAAGGCAAAAAGAGAAGCCAGG - Intronic
1145837866 17:27968335-27968357 ATAAGGAATCAAGTCAAGCGAGG - Intergenic
1146823960 17:36007733-36007755 CTAAGAGATCAAGACCAGCCTGG + Intergenic
1148653006 17:49263018-49263040 TTAGGGATTCAAGACAAGCCTGG + Intergenic
1149289920 17:55208055-55208077 ATAAGGCATCTAGTATAGCCTGG - Intergenic
1149404470 17:56333520-56333542 ATAATGCATCACGACTAGGCAGG - Intronic
1153766976 18:8384246-8384268 AGAGGGCTTCAAGACCAGCCTGG + Intronic
1153835842 18:8963035-8963057 ATCAGGCTGCAAGGCAAGCCTGG + Intergenic
1155172809 18:23279652-23279674 ACAAGGCAAGGAGACAAGCCTGG + Intronic
1155978959 18:32160989-32161011 AAAAGTCATCCAGACAAGCTGGG + Intronic
1156133295 18:34004916-34004938 CCAAGGCATCAAGAAAAGCAAGG - Intronic
1156655053 18:39275135-39275157 ATAAGACATCAGGGCAAGCAGGG + Intergenic
1157556189 18:48614231-48614253 GGAAGGCAGCAAAACAAGCCTGG + Intronic
1159378708 18:67628688-67628710 TCAGGGCCTCAAGACAAGCCTGG - Intergenic
1159946626 18:74448655-74448677 ACCAGGCATCAGGAGAAGCCTGG + Intronic
1162929348 19:13949167-13949189 ACAGGGGTTCAAGACAAGCCTGG - Intronic
1163079263 19:14925233-14925255 AGAAAACATCAGGACAAGCCTGG + Intergenic
1163280711 19:16315436-16315458 AAAATACATCCAGACAAGCCTGG + Intergenic
1163521974 19:17796785-17796807 TTCAGGAATCCAGACAAGCCAGG + Intronic
1163751807 19:19082571-19082593 GTCAGGCATCGAGACCAGCCTGG - Intronic
1164499915 19:28810080-28810102 ATAAGGCATTATGACAAGTTAGG + Intergenic
1165184003 19:34001246-34001268 ATAAGCCAGCAACACAAGGCCGG + Intergenic
1166227160 19:41403405-41403427 ATAAGGCATCCAGACGGGGCAGG - Intronic
1166565522 19:43763120-43763142 AAAAGGAATCAAGACAGGTCAGG + Intergenic
1166815867 19:45545193-45545215 ATAGGAAATCAAGACAAGGCAGG + Intronic
1166827803 19:45620322-45620344 ATCAGGAGTCAAGACCAGCCTGG - Intronic
1167044877 19:47043853-47043875 CTAAGAGTTCAAGACAAGCCTGG + Intronic
925424279 2:3735783-3735805 ATTAGGCACCAAGGAAAGCCTGG + Intronic
925567618 2:5273191-5273213 TCAAGGCATCAAGGCCAGCCTGG - Intergenic
926229407 2:10991223-10991245 ATGAGGCATCAAGAAAACCCAGG + Intergenic
927077992 2:19599158-19599180 ATAATCCAGCAAGAAAAGCCTGG - Intergenic
927170926 2:20368702-20368724 TCAGGACATCAAGACAAGCCTGG + Intergenic
927382254 2:22492484-22492506 ATAAGCCACCAAGCCCAGCCAGG + Intergenic
928551993 2:32381753-32381775 TTAAGAGCTCAAGACAAGCCTGG - Intronic
928562193 2:32500944-32500966 ATAAGAGTTCAAGACCAGCCTGG - Intronic
928787250 2:34903470-34903492 ATGAGGCATTAATACAAGGCAGG - Intergenic
929656034 2:43732719-43732741 ATAAGGAAGGAAGAAAAGCCAGG - Intronic
932048134 2:68370693-68370715 TTAAGAGTTCAAGACAAGCCTGG - Intronic
932767233 2:74478663-74478685 AAAAGGGTTCAAGACCAGCCTGG + Intronic
932943328 2:76195798-76195820 ATAAGACAGCAAGACAACCTGGG - Intergenic
933173094 2:79145600-79145622 ATCAGGGTTCAAGACCAGCCTGG - Intergenic
933176498 2:79179558-79179580 TTAAGACATCAAGACCATCCTGG - Intergenic
933319868 2:80759615-80759637 ATAAGGCAAAAAGACAACCCAGG + Intergenic
934540699 2:95171979-95172001 ATAAGGGGAAAAGACAAGCCGGG + Intronic
935030813 2:99320215-99320237 CTAAGAGTTCAAGACAAGCCTGG - Intronic
935579029 2:104739942-104739964 ATGAGGATTCAAGACCAGCCAGG - Intergenic
936967808 2:118144342-118144364 CCAAGGGTTCAAGACAAGCCTGG - Intergenic
937535017 2:122875490-122875512 ATGAGAAATCAAGACAAGGCAGG - Intergenic
937647843 2:124285588-124285610 CTAAGGGTTCAAGACCAGCCTGG + Intronic
938569948 2:132553768-132553790 CTAAGGCAGGATGACAAGCCAGG - Intronic
939859729 2:147404102-147404124 ATGAGGCATAAAGAAAACCCAGG - Intergenic
939860491 2:147414628-147414650 ATAAGGCATGCAGACAAGATTGG - Intergenic
940939616 2:159543743-159543765 TCAAGGGATCAAGACCAGCCTGG - Intronic
941479581 2:165989660-165989682 ATAAGACATGAAAACAAGACTGG - Exonic
943063175 2:183060145-183060167 ACAAGGGATCAGGACAAGACAGG + Intergenic
943336728 2:186624109-186624131 ATAAGAAATAAAGATAAGCCTGG - Intronic
943374409 2:187057202-187057224 TTTAGGCATCAAGACCAGTCTGG + Intergenic
944734249 2:202547406-202547428 CTAAGGAATAAAGAAAAGCCAGG - Intronic
945345659 2:208712222-208712244 AAAAGGCAACAAGACAACACAGG + Intronic
945784594 2:214217296-214217318 AAAAGGCAGCAAGACAAGTAAGG - Intronic
948514195 2:238493326-238493348 ATAAGACAAAAAGAAAAGCCAGG + Intergenic
948993012 2:241564208-241564230 CTGTGGCAACAAGACAAGCCCGG - Intronic
1169336373 20:4760487-4760509 AGAAGGCATCAAAACACACCAGG + Intergenic
1169373326 20:5045201-5045223 TTAGGGGTTCAAGACAAGCCTGG + Intergenic
1170454755 20:16521444-16521466 ATAAAGCATGAAGACAAGATTGG + Intronic
1170844098 20:19947701-19947723 CTCAGGCTTCAAGAAAAGCCAGG + Intronic
1174086206 20:48009572-48009594 ATAAGTCATCTGCACAAGCCTGG - Intergenic
1175167664 20:57056562-57056584 ATAAGGAATTAAGAAAAACCAGG - Intergenic
1178406838 21:32331546-32331568 ATGAGGCAAGAAGACAACCCAGG - Intronic
1178864872 21:36319324-36319346 ATAGGGGTTCAAGACCAGCCTGG - Intergenic
1179345771 21:40555844-40555866 ATAAGACTTCAAGACCAGTCAGG - Intronic
1181590282 22:23880000-23880022 TCAAGACATCAAGACCAGCCTGG + Intronic
1184451556 22:44585772-44585794 ATCAGTCCTCAAGAGAAGCCGGG + Intergenic
1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG + Intronic
1184618891 22:45658994-45659016 ATAAGGCATCCAGACCAGGTGGG - Intergenic
949392883 3:3582338-3582360 AGAAGGCATCAAGAAATGCAAGG - Intergenic
950038421 3:9903534-9903556 ATTTGGAATCATGACAAGCCTGG + Intronic
951952593 3:28217041-28217063 TTAAGAGATCAAGACAATCCTGG - Intergenic
952705226 3:36370436-36370458 ATAAGGCAAAAAGAAAATCCAGG + Intergenic
955176172 3:56615451-56615473 TGAAGGCAGCAAGACCAGCCTGG - Intronic
956562789 3:70600235-70600257 ATAAGGCATCAAGAAAAGGAAGG + Intergenic
956722555 3:72131243-72131265 ATAAGGCAGGAAGACCATCCAGG + Intergenic
956828528 3:73021516-73021538 ATAAGCCATCACGCCCAGCCTGG + Intronic
959665180 3:108912380-108912402 AGAAGACAACAAGACAAGTCAGG - Intronic
960046641 3:113205077-113205099 TTGTGGCATCAAGACAAACCTGG - Intergenic
961080487 3:124023088-124023110 AAAAGGAATAAAGACAAGCGTGG - Intergenic
963115465 3:141725311-141725333 ATAAACCAGGAAGACAAGCCAGG + Intergenic
963465811 3:145680540-145680562 ATAAGGCAAAAAGGCAAGCGGGG - Intergenic
963620673 3:147601516-147601538 TTAAGAGATCAAGACCAGCCTGG - Intergenic
964791433 3:160456281-160456303 TTGAGGCAGCAAGACAAGTCTGG + Intronic
965407748 3:168291651-168291673 ATAAGAGAGCAAGAAAAGCCAGG + Intergenic
968476586 4:813053-813075 TTAAGAGATCAAGACCAGCCTGG + Intronic
969098004 4:4748635-4748657 TTAAGGGTTCAAGACCAGCCTGG + Intergenic
975837373 4:78438851-78438873 ATAAGCCACGATGACAAGCCAGG - Intronic
977223548 4:94367451-94367473 ATAAGGCCACGAGACAAACCTGG + Intergenic
979410483 4:120372314-120372336 ATAAGGCAAAAATAAAAGCCAGG - Intergenic
979485210 4:121262916-121262938 ACAAGGCATCAACAGATGCCCGG + Intergenic
979748174 4:124243207-124243229 ATAAGACATAAAGAACAGCCAGG - Intergenic
979888095 4:126057596-126057618 CTAGAGCATGAAGACAAGCCTGG + Intergenic
980846218 4:138328634-138328656 ATAATGCATCAGGACCAACCAGG - Intergenic
981479112 4:145218476-145218498 ATAAGGCCTCAAGCCAAGCTGGG - Intergenic
983229700 4:165116610-165116632 TTAAGACTTCAAGACCAGCCTGG + Intronic
983727081 4:170941690-170941712 ATAAGGCCTGCAGACAAGACTGG + Intergenic
985487795 5:161747-161769 ACAAAGCATCAGTACAAGCCCGG - Intronic
986648090 5:9938185-9938207 ATAAAGCATGAAGACAAGATTGG + Intergenic
987095716 5:14547492-14547514 TCAAGAGATCAAGACAAGCCTGG + Intergenic
988167097 5:27607370-27607392 TCAAGACATCAAGACCAGCCTGG - Intergenic
989027162 5:37081095-37081117 CTAAGAGTTCAAGACAAGCCTGG + Intergenic
990231503 5:53717405-53717427 ATAAGGCATAAAGACAAGATTGG + Intergenic
990626664 5:57620969-57620991 GTAAGGCACCAAAACAAGCATGG + Intergenic
991060897 5:62374643-62374665 ATAAAGCTTAAAAACAAGCCAGG + Intronic
991776700 5:70092095-70092117 GTAAGGAATAAAGAGAAGCCTGG - Intergenic
991855987 5:70967542-70967564 GTAAGGAATAAAGAGAAGCCTGG - Intergenic
991870002 5:71100315-71100337 GTAAGGAATAAAGAGAAGCCTGG - Intergenic
992426607 5:76663859-76663881 ATGAGGCCTTAAGAGAAGCCAGG - Intronic
992849218 5:80788222-80788244 TTAAGGCATCGAGACCATCCTGG + Intronic
993594414 5:89834848-89834870 ATGAGCCATCAAGCCCAGCCTGG - Intergenic
997005396 5:129810952-129810974 ATCAGGCATACAGACAAGCCTGG - Intergenic
999784459 5:154878980-154879002 ATAAGGAATCAAGACCCACCTGG + Intergenic
1000089418 5:157917352-157917374 CTAAGGGTTCAAGACTAGCCCGG - Intergenic
1001096217 5:168777572-168777594 GTAAGGCATCAAAACAACCCAGG + Intronic
1001283506 5:170405556-170405578 AAAATGAATCAAGAGAAGCCAGG - Intronic
1001417583 5:171556793-171556815 ATAAGACATCCATACAAGGCTGG - Intergenic
1001876263 5:175204204-175204226 CCAAGACTTCAAGACAAGCCTGG + Intergenic
1002910893 6:1490201-1490223 ACATGGCGTCAAGACAAGGCTGG + Intergenic
1003241511 6:4349567-4349589 ATGAGGCATCACGCCAACCCCGG + Intergenic
1007454430 6:41965457-41965479 TCAAGGCATCAAGGCAATCCAGG - Intronic
1007668706 6:43533625-43533647 ATAAGAGTTCAAGACCAGCCTGG + Intronic
1008704889 6:54145560-54145582 CTAAGAATTCAAGACAAGCCTGG + Intronic
1011528273 6:88290689-88290711 ATAAGGCAGCTAGGCAGGCCAGG + Intergenic
1012289255 6:97431973-97431995 ATAAGGCAAGAAGAAAACCCAGG + Intergenic
1012493564 6:99809868-99809890 AGAAGGCATTAGGACAATCCAGG - Intergenic
1013533386 6:111040776-111040798 GAAAGGCATGCAGACAAGCCGGG + Intergenic
1015025961 6:128532706-128532728 ATAAGGCAGCTAGAATAGCCTGG - Intergenic
1015781688 6:136874460-136874482 TTAAGGGTTCAAGACCAGCCTGG + Intronic
1016722970 6:147323933-147323955 AGAAGACAGCAAGACAGGCCAGG - Intronic
1023090091 7:36609269-36609291 ATCAGGCAGCAAGACCAGCTAGG - Intronic
1023757352 7:43432037-43432059 TTAAGAGTTCAAGACAAGCCTGG - Intronic
1027241553 7:76333311-76333333 CTAAGGGTTCAAGACCAGCCTGG - Intronic
1027251644 7:76402389-76402411 TTAAGGGTTCAAGACTAGCCTGG - Intronic
1027561065 7:79730957-79730979 ATAAGTCACCATGACCAGCCTGG - Intergenic
1027706441 7:81539593-81539615 ATAAGGCAACAGGACAAGAAAGG - Intergenic
1028866189 7:95716434-95716456 ATAAGGCAAAAAGAAAACCCAGG - Intergenic
1030709194 7:112730282-112730304 CTAGGGGTTCAAGACAAGCCTGG - Intergenic
1031119689 7:117706919-117706941 ATAAAGCATTAAGACATGCCAGG - Intronic
1032369198 7:131328761-131328783 ATCAGGGATCAAGACAAAGCCGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032845891 7:135751686-135751708 ATAAGGCTTTAAGGCAAGCGAGG - Intergenic
1033181257 7:139181101-139181123 ATAAGAAACCAAGACTAGCCTGG + Exonic
1034639271 7:152589655-152589677 GTAAGCCATCATGACCAGCCTGG + Intergenic
1034996889 7:155583262-155583284 ATAAGCAGTCAAGAGAAGCCAGG - Intergenic
1035112671 7:156496252-156496274 ATTAGGCAACAAGGTAAGCCTGG - Intergenic
1035919968 8:3666184-3666206 ACAAAGCATCAAGCCAAGCGTGG - Intronic
1038223051 8:25628957-25628979 TTAAGACTTCAAGACCAGCCTGG + Intergenic
1038323109 8:26547657-26547679 ATAAAGAATCAGGACTAGCCAGG + Intronic
1039722939 8:40184468-40184490 GCAAGGCATCAAGTCAAACCAGG + Intergenic
1042273330 8:66977856-66977878 CTAAGAGATCAAGACCAGCCTGG - Intronic
1042607521 8:70560606-70560628 ATAAAGCCTCAACACAAGACAGG - Intergenic
1044026083 8:87174611-87174633 AACAGGCATCAAGACCATCCAGG - Intronic
1044603434 8:94028210-94028232 ATAAGACATCAAGTCATGGCTGG + Intergenic
1045204776 8:100027018-100027040 ACAAGAGTTCAAGACAAGCCTGG + Intronic
1047270550 8:123353606-123353628 AGAAACGATCAAGACAAGCCTGG - Intronic
1047733668 8:127747282-127747304 GTCAGGAATCAAGACCAGCCTGG + Intergenic
1048630964 8:136241919-136241941 CTAAGAGTTCAAGACAAGCCTGG - Intergenic
1048655960 8:136536138-136536160 ATAAGGCTTCAAAAGAACCCTGG + Intergenic
1048893952 8:138971957-138971979 ACAAGGCATGTAGCCAAGCCAGG - Intergenic
1050281804 9:4058305-4058327 ATAAGGCATAAAAAAAAGCATGG + Intronic
1050350234 9:4734221-4734243 AGAAGGCAACTAGACAGGCCAGG + Intronic
1051565572 9:18494144-18494166 GTCAGGAATCAAGACCAGCCTGG + Intronic
1055314885 9:75024208-75024230 AAAATGAATCAAGACAGGCCAGG - Intronic
1056219608 9:84438140-84438162 ATAAGGAATAAGGACCAGCCTGG - Intergenic
1057862948 9:98656405-98656427 ATAAGACAGCAACACAAGGCTGG - Intronic
1058912848 9:109536783-109536805 GCAAGGCAGCAAGAGAAGCCAGG - Intergenic
1060638878 9:125221884-125221906 GTCAGGCTTCAAGACCAGCCTGG - Intronic
1060986117 9:127819861-127819883 AAAAGGTATCAGGACCAGCCTGG - Intronic
1061024382 9:128038388-128038410 AAAAGAGTTCAAGACAAGCCTGG + Intergenic
1062569140 9:137176580-137176602 GAAAGGCATGAAGACAAGCCTGG + Intronic
1185996252 X:4953209-4953231 ATAGGAGTTCAAGACAAGCCTGG - Intergenic
1187019026 X:15360546-15360568 TTAAGAGATCAAGACCAGCCTGG - Intronic
1187516758 X:19978809-19978831 ATAGGAGATCAAGACCAGCCTGG - Intergenic
1187997336 X:24942303-24942325 ATATGGCAGAAAGAAAAGCCGGG - Intronic
1189721714 X:43926510-43926532 ATAAAGCATGAAGACAAGATTGG - Intergenic
1190561774 X:51693584-51693606 ATTAAGCAGCAAAACAAGCCAGG - Intergenic
1191834042 X:65445245-65445267 CTCAAGCATCAAGACAATCCAGG - Intronic
1192686159 X:73307193-73307215 ATAAGGCATGAAGACAGGATTGG + Intergenic
1192953035 X:76038318-76038340 ATAAGTCATGAAGACAAGATTGG - Intergenic
1193669136 X:84362344-84362366 ATAAGGCATCAGGAAAAGCTAGG + Intronic
1194284401 X:91991423-91991445 ATAAGGCAAAAAGAAAACCCAGG + Intronic
1198180402 X:134202452-134202474 ATAAGGCAAAAAGAAAACCCAGG - Intergenic
1199963575 X:152799571-152799593 ATAAGGCATAAAGAAAACACAGG + Intergenic
1200601970 Y:5215982-5216004 ATAAGGCAAAAAGAAAACCCAGG + Intronic
1201148751 Y:11082953-11082975 TTAAGGAAACAAGACAAGGCTGG - Intergenic