ID: 1131113057

View in Genome Browser
Species Human (GRCh38)
Location 15:89777104-89777126
Sequence ACTGTATCTTGGGGCAGTAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131113057_1131113062 -1 Left 1131113057 15:89777104-89777126 CCCTTACTGCCCCAAGATACAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1131113062 15:89777126-89777148 TCGCCCCCGTATTCGTCCCAAGG 0: 1
1: 0
2: 0
3: 0
4: 19
1131113057_1131113063 0 Left 1131113057 15:89777104-89777126 CCCTTACTGCCCCAAGATACAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1131113063 15:89777127-89777149 CGCCCCCGTATTCGTCCCAAGGG 0: 1
1: 0
2: 0
3: 0
4: 13
1131113057_1131113070 24 Left 1131113057 15:89777104-89777126 CCCTTACTGCCCCAAGATACAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1131113070 15:89777151-89777173 CAACCTCCGACGCGTCTCTTTGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131113057 Original CRISPR ACTGTATCTTGGGGCAGTAA GGG (reversed) Exonic
901468889 1:9441770-9441792 ACTGTATCTCTGGGCAGGGAGGG - Intergenic
901859098 1:12063079-12063101 ACCGTTTCTTGGGGCAGGAGTGG + Intergenic
902499911 1:16903640-16903662 TCTGTATCCTGGAACAGTAAGGG - Intronic
903080000 1:20802673-20802695 ACTGCATCTTGGACCAGAAAAGG + Intergenic
908609676 1:65843389-65843411 GCTGTACCTTGGGGAAGGAAAGG - Intronic
909934013 1:81530229-81530251 ACTGTATCCTGGGCCTGTACTGG - Intronic
911063810 1:93770026-93770048 ACTTTATCCTGGGACAGTGATGG + Intronic
914245732 1:145884830-145884852 ACTGGTTCTTGGGCCAGTCAAGG - Intronic
915825106 1:159067480-159067502 AGTGGAGCTTGGGCCAGTAAGGG + Intronic
919350452 1:196446483-196446505 GCAGCATCTTAGGGCAGTAAGGG + Intronic
921507738 1:215993278-215993300 AATTTATTTTGGGGAAGTAAAGG - Intronic
1069190484 10:65481524-65481546 ACTGTAGTTTGGGGAAGGAAAGG + Intergenic
1070166256 10:73900273-73900295 CCAGAATCTTGGTGCAGTAATGG - Intergenic
1079803073 11:24895840-24895862 TTTGGATCTTTGGGCAGTAATGG + Intronic
1084973494 11:72783939-72783961 TTTGGATCTTGGGTCAGTAAAGG + Intronic
1085765972 11:79281800-79281822 ACTTTATCCTGGGACATTAAAGG - Intronic
1085912915 11:80849788-80849810 ATAGTATCTTGGGGAAGTTATGG + Intergenic
1085937459 11:81165820-81165842 ACTGTAACTATGGGCAGTGATGG + Intergenic
1087964408 11:104394484-104394506 ACTGATTCTTAGAGCAGTAAAGG - Intergenic
1088566286 11:111176354-111176376 AAAGAATCTTGGGACAGTAAAGG + Intergenic
1088716546 11:112554470-112554492 ACTTTGTCCTGGGGCAGTCAGGG + Intergenic
1092624733 12:10314793-10314815 AATGTTTCTTGGGGCAGAGAAGG + Intergenic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1106353448 13:28956667-28956689 ACTGTAACTTGGAGGATTAAAGG + Intronic
1107375090 13:39795756-39795778 ACTATAACTTGGGATAGTAATGG - Intergenic
1108049504 13:46418147-46418169 AATATACTTTGGGGCAGTAAAGG - Intronic
1109059187 13:57591305-57591327 ACTGTATTCTGTGGCAGTAGTGG + Intergenic
1110507209 13:76300939-76300961 ACTGTATGCTGGGGCAGAGAAGG + Intergenic
1113302164 13:109034008-109034030 AATGCATCTTAGGGCAGAAAAGG + Intronic
1113429570 13:110237642-110237664 ACTGTATCTTGGGCCAGGCCTGG - Intronic
1124116583 15:26849041-26849063 ACTGAAGCTTGAGGCAGTCAGGG - Intronic
1125255770 15:37760996-37761018 TCTGTATCTCTGGGCAGTAAAGG + Intergenic
1125545687 15:40502662-40502684 AATGTGTTTAGGGGCAGTAATGG - Intergenic
1125757644 15:42074340-42074362 ACTGGAGCTTGGTGCAGTACCGG + Intronic
1128718040 15:69923466-69923488 ACTGGATCATCGAGCAGTAAAGG + Intergenic
1130395458 15:83497217-83497239 ACGGGGTCTTGGGGCTGTAACGG - Intronic
1131069483 15:89456809-89456831 ACAATATCTTGGAGCAGCAAAGG + Intergenic
1131113057 15:89777104-89777126 ACTGTATCTTGGGGCAGTAAGGG - Exonic
1133774663 16:8887250-8887272 TCTGTAGGTTGGGGCAATAATGG - Intergenic
1135428190 16:22357999-22358021 ACTGAATCTTGGAGAAGTGAAGG - Intronic
1136526566 16:30834888-30834910 GCTGGATCTTGGGGCAGCCAAGG + Exonic
1137922865 16:52508688-52508710 ACTATCTCTGGGGGCAGGAAGGG + Intronic
1146983766 17:37192167-37192189 CCTGTATCTCGGGGCAGCCAAGG - Exonic
1147644215 17:42024137-42024159 ACTGTCTCCTGGGGCAGTTGTGG + Exonic
1157716054 18:49888167-49888189 ATTCTTTCTTGGGGGAGTAAGGG + Intronic
1158839912 18:61374113-61374135 TGTGTATATTGGGGCAGGAAGGG + Intronic
1160561587 18:79761706-79761728 TCTGTCTCTTGGGTCAGTCAAGG + Intergenic
1163045854 19:14641372-14641394 AGTGTACCTTGGGGCAGAAAGGG + Intronic
1164907982 19:31983152-31983174 ACTGGATCCTGGGACAGAAAAGG + Intergenic
1166891918 19:45999305-45999327 TCTGTATTCTGGGGCAGTGAAGG + Intronic
927268098 2:21175404-21175426 AAAGTATGTTGGGGCAGCAATGG - Intergenic
929341480 2:40824128-40824150 GCTGCATCTTGGTGCAGTACTGG - Intergenic
932312657 2:70756169-70756191 GCTGTATGTTGGGGGAGGAAAGG - Intronic
936627447 2:114163563-114163585 ACTGTATCTTGGAACAGTCCTGG + Intergenic
939500832 2:142981683-142981705 ACTGTATTTTGAGGGAGGAAGGG - Intronic
942232624 2:173874159-173874181 TCTGGATCGTGGGGCAGGAATGG + Intergenic
944925190 2:204456971-204456993 CCTGTCTCTTGGGGAAGAAAAGG - Intergenic
948734354 2:239990590-239990612 AGTGGATCTTGGGGCAGGAACGG + Intronic
1172021884 20:31920411-31920433 ACTGTGTCTTGGGACAAGAATGG - Intronic
1174698283 20:52582193-52582215 ACTGTTTCTAGGGGCCTTAATGG - Intergenic
1175640416 20:60624914-60624936 ACTGCATCCTGGAGCAGGAAAGG - Intergenic
1180097956 21:45569248-45569270 ACAGGATCCTGGGGCAGAAAAGG + Intergenic
1183816735 22:40308118-40308140 AGGGTATCTTGGGGGAGGAAAGG - Intronic
949474619 3:4431625-4431647 ACTGAATATTGGAGCAGAAAAGG + Intronic
952173828 3:30839779-30839801 ACTGCATCTTGTGGCATGAACGG + Intronic
952465731 3:33583436-33583458 ACTGTACCTTTGGGAAGAAATGG + Intronic
952693922 3:36243573-36243595 ACTGTATTGTGTGGGAGTAATGG - Intergenic
953913220 3:46903254-46903276 CTTGTACCTTGGGGCAGTAAGGG - Exonic
955948686 3:64220511-64220533 GCTGTATCCTGGGGCACTGAAGG - Intronic
960169724 3:114445013-114445035 ACTGTATCTTGGAGCTTGAAGGG - Intronic
961573934 3:127819855-127819877 GCTGGATCTTGGGGCAGTCTTGG - Intronic
961933845 3:130562343-130562365 AATGTATCTTGGGCTAGAAAAGG - Intronic
962603569 3:137013323-137013345 AAAGTTTCTTGGAGCAGTAATGG + Intergenic
968051995 3:195661233-195661255 TCTGTATCCTGGAACAGTAAAGG - Intergenic
968286544 3:197512395-197512417 GCTGTGTCATAGGGCAGTAACGG - Intronic
968302118 3:197624698-197624720 TCTGTATCCTGGAACAGTAAAGG + Intergenic
968532537 4:1100905-1100927 TCTGTATCTAGCAGCAGTAAAGG - Intronic
970945914 4:21691449-21691471 ACTCTATATTGGAGCAATAAGGG - Intronic
973775443 4:54237320-54237342 ACTGTATCTGGAGGCACTGAAGG + Intronic
973982465 4:56317600-56317622 ACTGTATCTCTGGGCAGTAGTGG + Intronic
979664152 4:123292716-123292738 ACTGTCTCGTGGGGCTGGAATGG + Intronic
984386024 4:179059550-179059572 ACCAGAACTTGGGGCAGTAAGGG - Intergenic
986014060 5:3741982-3742004 ACTGGATCTTGGGTCAGAATAGG - Intergenic
986278258 5:6300863-6300885 ACTTTATCTTGGAGCCCTAACGG + Intergenic
988246865 5:28696348-28696370 ACTGTATCTTGCTGGAGTAGAGG + Intergenic
992080523 5:73231731-73231753 ACTGTTTCTTTGTGCAGAAATGG - Intergenic
992425857 5:76656722-76656744 ACTTTATATTGGGGCATAAAAGG + Intronic
994825279 5:104705840-104705862 ACATTATCTGGGTGCAGTAAAGG + Intergenic
999071782 5:148750773-148750795 ACTGTGGGTTGGGGCAGGAAGGG - Intergenic
999825102 5:155266271-155266293 ACTGTGCCTTGGGCCAGTCAAGG + Intergenic
1003684695 6:8290378-8290400 ACTGTATCTTGGGGGAAAAGGGG - Intergenic
1004561188 6:16752593-16752615 GCTAGAACTTGGGGCAGTAAGGG - Intronic
1005804796 6:29464110-29464132 GCTGTAACTTGAGGCAGTGAAGG - Exonic
1007995409 6:46302683-46302705 ACTGAAACTTGGGGCATTGATGG + Intronic
1010684309 6:78833944-78833966 AAAGTATCTTGGGGCAGCAGTGG - Intergenic
1010813619 6:80328829-80328851 GCTTTATCTAGGGGCAGTAAAGG - Intronic
1013721828 6:113039680-113039702 ACTGATTCTTAGGGCACTAAGGG - Intergenic
1015690991 6:135922499-135922521 TCTGTATAGTGGGGCAGTAAAGG - Intronic
1016225842 6:141736119-141736141 AATGTATCTTGTGGCAATCATGG - Intergenic
1019038189 6:169079935-169079957 ATTGGATCCTGGGGCAGAAAAGG + Intergenic
1019147446 6:169984393-169984415 ACTCTTTCTAGGGGCTGTAAAGG - Intergenic
1020894328 7:13920616-13920638 ACTGCATTTTAAGGCAGTAATGG - Intronic
1021955423 7:25819877-25819899 ACTGTATCTCGAGGAAGAAAAGG + Intergenic
1026814490 7:73499692-73499714 ACCCTATCTTGGGGCATTAGAGG + Intronic
1030139072 7:106286186-106286208 ATTCTATCTGGGGGCAGTGATGG + Intronic
1031900892 7:127409629-127409651 CCTGGACCATGGGGCAGTAATGG - Intronic
1035134066 7:156683561-156683583 AGTGTATGTTGGAGCTGTAATGG - Exonic
1039874721 8:41576145-41576167 ACTGGTTCTGGGGGCAGAAAAGG + Intergenic
1039920639 8:41891937-41891959 AATGTATGTTGTGGCATTAATGG - Intronic
1046751563 8:117932428-117932450 ACTGAGTCTGGGGGCAGGAAGGG + Intronic
1048061046 8:130919522-130919544 ACTGTCTCTTTGGGAAGAAAAGG + Intronic
1051602415 9:18888614-18888636 ACTCTTTCTTGGTGCAGTGAAGG - Intronic
1052587464 9:30447959-30447981 AGAGTATCTTGGGGCAGGGAAGG - Intergenic
1057880315 9:98788125-98788147 ACTGCATCTTGGGGAAATGAGGG + Intronic
1058025547 9:100139350-100139372 CTTTTATCTTGGGGCAGAAATGG - Intronic
1060763999 9:126280308-126280330 ACTGTAACTAGGAGCTGTAAAGG + Intergenic
1061911950 9:133729643-133729665 ACTGAGGCTTGGGGCAGTGAGGG + Intronic
1188362156 X:29268329-29268351 ACTATTTCATGGCGCAGTAATGG + Intronic
1193445434 X:81595810-81595832 ACTGTATCTTGGGAAAAAAATGG - Intergenic
1202366483 Y:24169077-24169099 ACAGTATCTCTGGGCAGCAATGG + Intergenic
1202504299 Y:25501046-25501068 ACAGTATCTCTGGGCAGCAATGG - Intergenic