ID: 1131118439

View in Genome Browser
Species Human (GRCh38)
Location 15:89808582-89808604
Sequence GGGGACAAGCTGGGAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 1, 2: 4, 3: 49, 4: 641}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131118439 Original CRISPR GGGGACAAGCTGGGAGACAG AGG (reversed) Intronic
900767419 1:4514465-4514487 GGGGACATGCGGGTAGAGAGAGG - Intergenic
900964328 1:5947318-5947340 GGGGACACCCTGGGGGACACAGG + Intronic
900981352 1:6047902-6047924 GGGGACAAGCTCGTAGCAAGAGG + Intronic
901123928 1:6916101-6916123 GGGGACGAGAAGGGAGCCAGGGG + Intronic
901474491 1:9480190-9480212 GGGGCCAAGCTGGGTGACCCAGG + Intergenic
901768741 1:11519904-11519926 GGGGTGGAGCTGTGAGACAGGGG - Intronic
902306767 1:15546327-15546349 AGGGGCAAGCTGGGAGACTGAGG + Intronic
902470809 1:16646726-16646748 AGGGGCAGGGTGGGAGACAGGGG + Intergenic
902487364 1:16757956-16757978 CAGGACAAGCTGGGAGCCTGAGG + Intronic
902487991 1:16760722-16760744 AGGGGCAGGGTGGGAGACAGGGG - Intronic
902600152 1:17535463-17535485 GGGGCCAGACTGGGAGGCAGCGG + Intergenic
902673908 1:17995038-17995060 TGGGAGAACCTGGGAGGCAGAGG - Intergenic
902787154 1:18740117-18740139 GGGGAGATGCGGAGAGACAGAGG + Intronic
903204181 1:21768121-21768143 GGCGTGAAGCTGGGAGGCAGAGG + Intronic
903279699 1:22243623-22243645 GGGGACACCCTGGGAGCCACAGG - Intergenic
903682942 1:25109164-25109186 GGGGAAAAGGAGAGAGACAGAGG - Intergenic
904031262 1:27534828-27534850 GGGGGCAGGGTGGGAGGCAGAGG + Exonic
904036428 1:27561466-27561488 GGGGAGCTGCTGGGAGGCAGAGG + Intronic
904746986 1:32717388-32717410 GAGGACAAGCTGGGCAAGAGAGG - Intergenic
905077797 1:35289254-35289276 GGGAGCAAGATGGGAAACAGAGG + Intronic
905277764 1:36829986-36830008 GGCAGCAAGCTGGGAGTCAGAGG - Intronic
905342735 1:37290340-37290362 AGCGACTAGCAGGGAGACAGAGG - Intergenic
905410628 1:37765626-37765648 GGGGATGAGCTAGGAGACACCGG - Intergenic
905807291 1:40886137-40886159 GGGGAGAAGTTTGGAGACATGGG - Intergenic
906248096 1:44291121-44291143 GGGGTCAAGCTAGGAAATAGGGG + Intronic
906578904 1:46917980-46918002 GGGGGAAAGCTGGTAGTCAGAGG + Intergenic
906945629 1:50292009-50292031 GGGGGCCAGATGGGAGGCAGGGG + Intergenic
906952639 1:50347298-50347320 TGGGCCAAGCTAGGATACAGAGG - Intergenic
907305272 1:53509696-53509718 TGAGAGAAGCTAGGAGACAGGGG - Intronic
907506218 1:54920418-54920440 GGGGACTAGGTGGGACAAAGTGG - Intergenic
908491643 1:64650359-64650381 GAGGACCAGCATGGAGACAGAGG - Intronic
908570991 1:65409992-65410014 GCGGATTAGCTGGGAAACAGAGG + Intronic
909304199 1:74051648-74051670 GGGGAGATGGTAGGAGACAGGGG - Intronic
909467177 1:75985254-75985276 AGGGAAATGCTGGCAGACAGGGG + Intergenic
910247780 1:85160639-85160661 GGGGAAAAGCAAGGAGATAGTGG - Intronic
910414678 1:86984820-86984842 CGGGAGAACCTGGGAGGCAGAGG + Intronic
911897531 1:103456155-103456177 GGGGACATGGCTGGAGACAGGGG + Intergenic
912296078 1:108472276-108472298 GGGGACAAGGTGGGAGACATAGG - Intergenic
913168127 1:116208318-116208340 GGAGAGAAGCCGGAAGACAGCGG - Intergenic
913334884 1:117700346-117700368 GGGGCCAAGATGTAAGACAGTGG - Intergenic
913542302 1:119833212-119833234 GGAGACAAGGTGGGAAACACAGG + Intergenic
914435850 1:147658713-147658735 GGGGAGAAGCCAGGAGCCAGAGG + Intronic
915597093 1:156902044-156902066 GGAGACAAGCTGCCAGAAAGAGG + Intronic
915685206 1:157625513-157625535 ACGGACCAGCTGGGAAACAGGGG + Intergenic
916060503 1:161095239-161095261 GGGGACAGCCTGGGAGACATGGG + Intergenic
917397205 1:174606345-174606367 GGGCACAATCTGAAAGACAGTGG - Intronic
917477240 1:175379273-175379295 GATGAGAACCTGGGAGACAGAGG + Intronic
917973322 1:180222470-180222492 GAGGACAGGCTGTGAGGCAGGGG - Intergenic
918158187 1:181871573-181871595 GGGGAAAAGGTGGGAGAAGGGGG + Intergenic
919594706 1:199547369-199547391 AGGGACAAGCAGGCAGAAAGAGG + Intergenic
919809171 1:201398431-201398453 AGGGACAAGATGGGGGACGGGGG + Intronic
919917983 1:202150840-202150862 GGCGCCAAGGTGGGAAACAGAGG - Intronic
920100722 1:203515477-203515499 GGGGACAAGCCTGGAGTCTGAGG + Intergenic
920831860 1:209472668-209472690 GAGTAAAAGGTGGGAGACAGTGG + Intergenic
921209851 1:212885632-212885654 GGCGTGAAGCCGGGAGACAGAGG - Intronic
921263387 1:213403283-213403305 GGAGTCCTGCTGGGAGACAGAGG + Intergenic
921734525 1:218612126-218612148 GGGGAGAAGAAGGGAGAAAGAGG - Intergenic
921843914 1:219859091-219859113 GGGGTCAACCTGGGACACCGAGG - Intronic
922774388 1:228208126-228208148 GGGCACAGGCTGGGAGGCAGGGG - Exonic
922900092 1:229129927-229129949 AGGGTTAAGCTGAGAGACAGAGG - Intergenic
923035744 1:230283931-230283953 GGGGACAGCCTGGGAGGAAGAGG + Intergenic
923594875 1:235353357-235353379 GGGTAGGACCTGGGAGACAGAGG + Intergenic
924809882 1:247391605-247391627 GGGAACAGGTTGGGAGTCAGTGG + Intergenic
1063095297 10:2903625-2903647 AGGGACACGCTGGGAGGCTGTGG - Intergenic
1064873809 10:19970072-19970094 GGGAAGAGGCTGGGGGACAGAGG - Intronic
1065449700 10:25844114-25844136 GGGGACAAGGTGGGAGTGAGAGG - Intergenic
1065989311 10:30992296-30992318 GGGTAGAAGCTGGAAGACTGTGG + Intronic
1066243940 10:33563673-33563695 AGAGACAAGCCAGGAGACAGAGG + Intergenic
1067064035 10:43093686-43093708 TGGGAGCAGCTGGGAGAAAGTGG + Intronic
1067084537 10:43230785-43230807 GCAAACAAGCTGGGAGGCAGAGG - Intronic
1068645171 10:59457999-59458021 GGGGACCAGCTGGGAGGCTGTGG + Intergenic
1069417253 10:68211538-68211560 GTGGAAAAGTTGGGAGAAAGGGG + Exonic
1069779286 10:70944714-70944736 GGAGACCAGCTGGGGGGCAGAGG - Intergenic
1069881657 10:71597240-71597262 GGAGACCAGCTAGGGGACAGAGG - Intronic
1069944219 10:71974828-71974850 GGTGGGAAGGTGGGAGACAGTGG - Intronic
1069962552 10:72087418-72087440 GGGGAGCAGCTCGGAGCCAGAGG - Intronic
1070360608 10:75684901-75684923 GATGACAAACTGGGAGAAAGTGG - Intronic
1070558552 10:77548482-77548504 GTGTACATGCTGGGAGTCAGAGG - Intronic
1070683120 10:78462936-78462958 GGGGCTGAGCTGGGAGAGAGTGG - Intergenic
1071024207 10:81093008-81093030 GGGGAAAAGCTGGCAGTCACAGG + Intergenic
1071786490 10:88906086-88906108 GGGGACAAGTTGGGAGACACAGG + Intronic
1072463396 10:95640977-95640999 GGAGACAAGCTGGAAAGCAGAGG - Intronic
1073115241 10:101088034-101088056 GGGGGGAAGCTGGGAGGAAGGGG + Intergenic
1073454588 10:103628873-103628895 GTGGGCAATCTGGGAGACACAGG - Intronic
1073532169 10:104242935-104242957 AGGGTGAACCTGGGAGACAGAGG - Intronic
1075050337 10:119178715-119178737 GGGGACAGGCGTGGAGACACTGG - Intronic
1075475660 10:122731156-122731178 GGAGGGAAGGTGGGAGACAGGGG + Intergenic
1076040250 10:127241481-127241503 GTGCACAAACTTGGAGACAGAGG - Intronic
1076178036 10:128383688-128383710 GGAGACAACCTGAGAGCCAGTGG + Intergenic
1076570918 10:131432389-131432411 GGGAACCTGCTGGGAGGCAGCGG + Intergenic
1076738320 10:132468482-132468504 GGGGAGGAGATGGGAGGCAGGGG + Intergenic
1076934440 10:133558132-133558154 AGGCACAAGCCTGGAGACAGGGG + Intronic
1079286814 11:19141481-19141503 GTGGACAAGCAGGCAGGCAGAGG - Intronic
1080401246 11:31937997-31938019 TGGGAGAATCTGGGAGGCAGAGG - Intronic
1080553278 11:33392983-33393005 GGGGACAAGACTAGAGACAGGGG - Intergenic
1080641283 11:34160010-34160032 TGTGAAAAGCGGGGAGACAGAGG + Intronic
1080788522 11:35498706-35498728 GGAGAGAAGGTGGGAAACAGTGG - Intronic
1081631423 11:44692584-44692606 GGTGACCAGCTGGGAGTCACGGG + Intergenic
1081962745 11:47150436-47150458 AGCCACAAGCAGGGAGACAGAGG + Intronic
1082691356 11:56308369-56308391 CAGGAAAAGCTGGGAAACAGGGG + Intergenic
1083657257 11:64235459-64235481 GGCATCAGGCTGGGAGACAGGGG - Exonic
1083681614 11:64354215-64354237 GGTGCCAAGGTGGGGGACAGAGG - Intronic
1084469169 11:69345392-69345414 GGGGACAAGCCTGGAGATGGGGG - Intronic
1084521407 11:69665263-69665285 GGAGAGAAGGTGGGGGACAGTGG + Intronic
1085484660 11:76851813-76851835 GGGGAAATCCTGGGAGACAAGGG + Intergenic
1085519423 11:77129444-77129466 GGAGACAGGTTGGGAGCCAGAGG + Intronic
1087960733 11:104345620-104345642 GAGGGCAAGGTGGGAGATAGTGG + Intergenic
1089141036 11:116284297-116284319 GGGCCCAACCTGGGAGACTGAGG - Intergenic
1089202249 11:116731572-116731594 GGAGAGAAGATGGGAGAGAGGGG + Intergenic
1089308005 11:117538789-117538811 GGGGAGAAGGTGATAGACAGGGG + Intronic
1089391543 11:118105489-118105511 GGGTACTAGCTGGGAGGTAGAGG + Intronic
1089487270 11:118856322-118856344 GGAGACTAGCTGGGAGGTAGGGG + Intergenic
1090075328 11:123577221-123577243 GGGGAGAAACCGGGAGAGAGGGG - Intronic
1090217707 11:124984394-124984416 TGGGAGAGGCTGGTAGACAGGGG + Intronic
1090426386 11:126609517-126609539 GGGGACCTGCTGGGAGAGAGGGG + Intronic
1090751355 11:129748991-129749013 GGAGAGATGATGGGAGACAGAGG + Intergenic
1090924678 11:131239118-131239140 GTGGACAAGATAGGACACAGAGG - Intergenic
1091000449 11:131906575-131906597 GGGGACAGCCTGAGAGCCAGGGG - Intronic
1091042743 11:132297275-132297297 GGGGACCACTTGGGGGACAGAGG - Intronic
1091287285 11:134414687-134414709 GAGGCCAAGCAGGAAGACAGGGG - Intergenic
1091332792 11:134743813-134743835 GAGGAAATGGTGGGAGACAGGGG - Intergenic
1091584864 12:1810386-1810408 GGGGACAGGCTGGAGGACCGGGG - Intronic
1091969855 12:4777714-4777736 GGGGAATAGCTGGGACTCAGGGG - Intronic
1092761641 12:11816326-11816348 GGTGTGAACCTGGGAGACAGAGG - Intronic
1093065585 12:14654784-14654806 TGGGAGAAGATGAGAGACAGAGG + Intronic
1093991398 12:25592933-25592955 GGGGAAAAGCTGGCAGTCACAGG - Intronic
1095916451 12:47484856-47484878 GGAGACAATCAGGGAGTCAGTGG + Intergenic
1097022985 12:56033981-56034003 GGCGTGAACCTGGGAGACAGAGG - Intronic
1097042778 12:56165538-56165560 GGGGATAGGCTGGGAGCCTGGGG + Exonic
1097866970 12:64567131-64567153 GGAGCCAGGCTGGGAGACAAAGG + Intergenic
1097960650 12:65529085-65529107 GGGGACATGCAGGGAGAAAGAGG - Intergenic
1098143596 12:67475693-67475715 GGGGAAAGGCAGGGATACAGAGG - Intergenic
1099488169 12:83253468-83253490 GGGGAGCAGGTGGGAGACAAGGG - Intergenic
1099804398 12:87499363-87499385 AGTTACAGGCTGGGAGACAGAGG + Intergenic
1100481549 12:94984219-94984241 GTGGACAAGCTAGGAAACATGGG - Intronic
1100685904 12:96985739-96985761 GGGGACAAGGAGGGGGAGAGGGG + Intergenic
1100809361 12:98323476-98323498 GGGGACTACTAGGGAGACAGAGG - Intergenic
1101603633 12:106231747-106231769 GGGGAGAAACAGGGAGACAACGG + Intergenic
1102033404 12:109757737-109757759 GGGAACAGGCAGGGAGCCAGGGG + Intronic
1102260436 12:111440017-111440039 GGGGGGAAGATGGGGGACAGAGG + Intronic
1103576695 12:121882823-121882845 CAGGAGAAGCTGGGAGGCAGAGG - Intergenic
1103600794 12:122053376-122053398 TGGGACAGGCCGGGACACAGAGG - Intronic
1103708674 12:122895359-122895381 GGGGACAACCAGGGGGACTGAGG - Intronic
1103929058 12:124439565-124439587 GGAGACAGACAGGGAGACAGAGG + Intronic
1104963081 12:132497488-132497510 GGGGGCAGCCTGGGACACAGGGG - Intronic
1104973702 12:132542696-132542718 GGGGAGGAGATAGGAGACAGAGG - Intronic
1105628626 13:22138675-22138697 GGGGACAGGGTGGGTTACAGAGG + Intergenic
1105788243 13:23770587-23770609 GAGGCCAAGCTGGCAGGCAGGGG - Intronic
1105794141 13:23834017-23834039 GGGGTCAGGGTGGGAGGCAGGGG - Intronic
1105811606 13:24000976-24000998 GGGGAGAAGCTGAAAAACAGTGG - Intronic
1105867439 13:24473671-24473693 GAGGAAGAACTGGGAGACAGAGG - Intronic
1106228407 13:27802318-27802340 GGAGAGAACCTGGGAGGCAGAGG + Intergenic
1106234877 13:27853273-27853295 AGGGAAAAGCTGGGAGGTAGGGG + Intergenic
1106453803 13:29909505-29909527 GGTGACATGGTGGGAGGCAGTGG - Intergenic
1106593372 13:31116893-31116915 GGGGGTAAGCTGGGAGGAAGAGG + Intergenic
1109328462 13:60899330-60899352 GGGAACAAGCTGGGAGAAGCTGG + Intergenic
1109430022 13:62220017-62220039 TGGGTCAGGCTGGGAGGCAGGGG - Intergenic
1110963515 13:81660809-81660831 TGGGACAGCCTGGGTGACAGAGG + Intergenic
1112348696 13:98614600-98614622 GGGGCAATGCTTGGAGACAGTGG + Intergenic
1113394305 13:109931666-109931688 GTGGAACAGCTGAGAGACAGGGG + Intergenic
1118068927 14:62223901-62223923 TGGGAGAAGCCGGCAGACAGGGG + Intergenic
1118981354 14:70719260-70719282 GGGGACAACCTTGAAGCCAGTGG + Intergenic
1121667923 14:95686551-95686573 GGGGAGAACCTGGGTGACTGTGG + Exonic
1121976126 14:98405627-98405649 AGGGGCCAGCTGGGAGACACTGG - Intergenic
1122719908 14:103716109-103716131 GCGGCCAACCTGGGAGAGAGCGG - Intronic
1122986577 14:105214372-105214394 GGAGACAAGCTCGGAGGGAGCGG + Intronic
1123090012 14:105738314-105738336 GGGGACAGCATGGGGGACAGTGG + Intergenic
1123090180 14:105738911-105738933 GGGGACAGCTTGGGGGACAGTGG + Intergenic
1123114981 14:105890507-105890529 GGGGTCCAGCTGGGAGGAAGTGG + Intergenic
1123117167 14:105899955-105899977 GGGGTCCAGCTGGGAGGAAGGGG + Intergenic
1124400879 15:29346270-29346292 GGGGACATGCTCTGAGAGAGAGG + Intronic
1125067117 15:35500840-35500862 AGGGAGAACCTGGGAGGCAGAGG - Intronic
1126383942 15:48074981-48075003 GGGGACGGGCTGGGAGAAGGTGG - Intergenic
1126675772 15:51158304-51158326 AGGGGCAAACTGGGAGTCAGTGG - Intergenic
1127525270 15:59786606-59786628 GGGGGAAAGCTGGGAGTCACAGG + Intergenic
1127644507 15:60946249-60946271 GGGGAGAAGGAGGGAGAGAGAGG - Intronic
1127734959 15:61831415-61831437 GGGGAGAGGCTCGGTGACAGGGG + Intergenic
1127857954 15:62967902-62967924 GAGGACAAGCAGGGAGGGAGTGG - Intergenic
1128065631 15:64762898-64762920 GGGGACAAGATGGAAGTCAGGGG + Intronic
1128545991 15:68568124-68568146 AGGGTCAACCTGGGAGACACAGG + Intergenic
1129871690 15:78945370-78945392 GGGGACACGCAGGGAGATGGGGG - Intronic
1129871728 15:78945495-78945517 GGGGACAGGCAGGGAGATGGAGG - Intronic
1129871758 15:78945590-78945612 GGGGACAGGCAGGGACATAGGGG - Intronic
1129871793 15:78945685-78945707 GGGGACAGGCAGGGAGATGGGGG - Intronic
1129871804 15:78945717-78945739 GGGGACAGGCAGGGAGATGGGGG - Intronic
1129871852 15:78945876-78945898 GGGGACAGGCAGGGAGATGGGGG - Intronic
1129871893 15:78946000-78946022 GGGGACAGGCAGGGACATAGGGG - Intronic
1129871933 15:78946126-78946148 GGGGACAGGCAGGGACATAGGGG - Intronic
1129871960 15:78946222-78946244 GGGGACAGGCAGGGAGATGGGGG - Intronic
1130202914 15:81850118-81850140 GGGGACAATCTGAGGGACAAGGG + Intergenic
1131118439 15:89808582-89808604 GGGGACAAGCTGGGAGACAGAGG - Intronic
1131123260 15:89836500-89836522 GGCAACAAGCTGGGAGAAGGTGG + Intronic
1131228835 15:90646127-90646149 GGGGAGCAGCTGGGACACGGCGG - Intergenic
1131434855 15:92414467-92414489 GGAGACAATCTGTCAGACAGAGG + Intronic
1131456863 15:92588424-92588446 GGGGAAGACCTGAGAGACAGTGG + Intergenic
1132878708 16:2151626-2151648 GAGGACAAGTTGGGGGACAGGGG + Intronic
1133116051 16:3578596-3578618 GGTGACAAGGTGGGAGCCAAGGG + Intergenic
1133210365 16:4260237-4260259 GGGCAGAAGCTGCAAGACAGAGG + Exonic
1133931592 16:10237146-10237168 AGGGAGAATCTGGGAGGCAGAGG - Intergenic
1135700263 16:24626156-24626178 GAGGACAAGATGGGAGAGGGAGG - Intergenic
1136123331 16:28156368-28156390 GGGGTGATGCTGGCAGACAGAGG + Exonic
1137469021 16:48737993-48738015 ACGGAGAAGCTGGGAGACATCGG - Intergenic
1137485718 16:48889144-48889166 GGGGCCAGGCAGGGAGGCAGTGG - Intergenic
1137578105 16:49617221-49617243 GGGGCCCAGCGGGGAGAAAGTGG - Intronic
1137707231 16:50544047-50544069 GGAGAAAAGATGGGAGCCAGAGG - Intergenic
1138438127 16:57017915-57017937 GGGAATAATCTTGGAGACAGAGG - Intronic
1138884861 16:61064337-61064359 GGGAACAAGCTGGGAATCAAGGG + Intergenic
1139584355 16:67892196-67892218 AGCTACAACCTGGGAGACAGAGG - Intergenic
1139953448 16:70682563-70682585 GGGGACAAGATGGGGCGCAGGGG + Intronic
1140223054 16:73058056-73058078 GGGTACCAGCTCGGAGACAAAGG - Intronic
1141301424 16:82819580-82819602 GAGGGCAACATGGGAGACAGAGG + Intronic
1141484955 16:84332720-84332742 AGGCACAACCAGGGAGACAGAGG + Intergenic
1141712763 16:85709658-85709680 GGTGAGGAGGTGGGAGACAGAGG - Intronic
1141883018 16:86872411-86872433 GGAGACGAGGAGGGAGACAGTGG - Intergenic
1141985171 16:87575233-87575255 CTGGAGAAGCTGGGAGGCAGTGG - Intergenic
1142052010 16:87965141-87965163 TGGGACCAGCAGAGAGACAGAGG + Intronic
1142415101 16:89936842-89936864 GGGCAGAACCTGGGAGACTGAGG - Intergenic
1143151982 17:4812898-4812920 GAGGAGAAGCTGGGAGTCAGTGG + Intronic
1143205039 17:5135458-5135480 GGGGTCAAGCTGAGACACAAAGG + Intronic
1143217838 17:5238557-5238579 GGGGCCAGGGTGGGAGACAGAGG - Intergenic
1144495243 17:15741624-15741646 GGGGTCAGGCTGGGGGACATGGG - Intronic
1144876082 17:18398148-18398170 GGGGTCAAGCTGAGACACAAAGG + Intergenic
1145042001 17:19583899-19583921 GTGGAAAAGCTGGGAGCCAGGGG + Intergenic
1145156146 17:20546272-20546294 GGGGTCAAGCTGAGACACAAAGG - Intergenic
1146160765 17:30558455-30558477 GGGGTCAAGCTGAGACACAGAGG + Exonic
1146185993 17:30724580-30724602 GGAGACAAGGCGGGAGTCAGAGG + Intergenic
1146266713 17:31457738-31457760 AGGGCCAAGTTGAGAGACAGAGG - Intronic
1146272172 17:31491661-31491683 GGGGACAAGCTCAGAGAGATGGG + Intronic
1146843615 17:36170357-36170379 GGGGTCAAGCTGAGACACAAAGG - Intronic
1146855922 17:36258295-36258317 GGGGTCAAGCTGAGACACAAAGG - Intronic
1146864698 17:36330080-36330102 GGGGTCAAGCTGAGACACAAAGG + Intronic
1146871828 17:36382206-36382228 GGGGTCAAGCTGAGACACAAAGG - Intronic
1146879189 17:36433288-36433310 GGGGTCAAGCTGAGACACAAAGG - Intronic
1146883123 17:36454434-36454456 GGGGTCAAGCTGAGACACAAAGG - Intergenic
1146962922 17:37000116-37000138 GGGGGCAAGGTGGCAGACAGGGG + Intronic
1147067560 17:37930674-37930696 GGGGTCAAGCTGAGACACAAAGG + Intronic
1147074714 17:37982830-37982852 GGGGTCAAGCTGAGACACAAAGG - Intronic
1147079089 17:38010229-38010251 GGGGTCAAGCTGAGACACAAAGG + Intronic
1147086237 17:38062369-38062391 GGGGTCAAGCTGAGACACAAAGG - Intronic
1147095028 17:38134171-38134193 GGGGTCAAGCTGAGACACAAAGG + Intergenic
1147102183 17:38186334-38186356 GGGGTCAAGCTGAGACACAAAGG - Intergenic
1147706519 17:42429120-42429142 GAGGAGAATCTGGGAGGCAGAGG - Intergenic
1147800514 17:43083197-43083219 GGTGCCAACCTGGGTGACAGAGG - Intronic
1147802826 17:43106033-43106055 AGGAAGAGGCTGGGAGACAGAGG + Intronic
1147811037 17:43170051-43170073 GCAGGCAAGCTGGGAGACGGAGG + Intergenic
1147868385 17:43569652-43569674 AGGGCCAAGCTGGGTGACAGAGG - Intronic
1148051487 17:44772071-44772093 GGGGGCACCCTGAGAGACAGGGG - Intronic
1148085364 17:44990594-44990616 TGGGAGAAGCTGGGGGTCAGAGG - Intergenic
1148235356 17:45964959-45964981 GGGGGGCAGCTGGGAGAAAGTGG - Intronic
1148551182 17:48551562-48551584 GAGGACAGGATGGGAGACTGAGG + Intronic
1149595938 17:57864731-57864753 GGGGACAAGCTGGAAGTCCTAGG + Intronic
1150626798 17:66847186-66847208 AGGGACACTCTGGGAGACAGAGG - Intronic
1150804914 17:68311070-68311092 CGGGAGAACCTGGGAGACAGAGG + Intronic
1151249230 17:72820788-72820810 GGGCAGAAACTGGGGGACAGAGG + Intronic
1151578246 17:74963493-74963515 GGAGAGAAGCTGAGAGCCAGGGG - Intronic
1152023214 17:77792685-77792707 GGCCACAAGCTAGGAGGCAGGGG + Intergenic
1152212137 17:79008348-79008370 GAGGAAGAGCTGGGAGATAGCGG + Intronic
1152696035 17:81796067-81796089 GGGGACAAGCCGGGAGGCCCCGG - Intergenic
1152702195 17:81824672-81824694 GGGGACACCCTGGTAGGCAGAGG - Exonic
1152755984 17:82087258-82087280 GGGGACAGGCTGGGTGAGTGCGG + Intronic
1152935934 17:83136855-83136877 GGGGAAGAGCTGGAATACAGGGG - Intergenic
1152961573 18:83327-83349 GGGGACCTGCTGGGGGCCAGTGG - Intergenic
1153565479 18:6414308-6414330 GGGGACACGCGGGCAGACGGGGG + Intronic
1153675910 18:7455455-7455477 AGGGAGAAGGTGGGACACAGGGG - Intergenic
1154012751 18:10589719-10589741 GGCGTGAACCTGGGAGACAGAGG - Intergenic
1154039940 18:10844703-10844725 GGCGTGAACCTGGGAGACAGAGG + Intronic
1154145217 18:11861294-11861316 GGGGACAATTCTGGAGACAGAGG - Intronic
1154268161 18:12896897-12896919 GGGAACAAACCGGGAGAAAGAGG + Intronic
1154500157 18:14992037-14992059 GGGGTCAGGCTGGGGGACATGGG + Intergenic
1154976403 18:21461451-21461473 GGGGAGTGACTGGGAGACAGAGG - Intronic
1155190166 18:23422574-23422596 GGGGGCAACCTTGGAGAGAGGGG - Intronic
1155365693 18:25047326-25047348 GGGGACATGATGGGACACAGGGG - Intergenic
1156116817 18:33795613-33795635 TGGTACAAGTTGGGAGACAATGG - Intergenic
1157121999 18:44919653-44919675 GGGGACAAGCTTAAAGACGGGGG - Intronic
1159023747 18:63164518-63164540 GGGGAAAGACTGGGAGGCAGTGG + Intronic
1159087477 18:63809946-63809968 GGGGAGAAGCTGGATGGCAGGGG + Intergenic
1160788862 19:913494-913516 GGGGACGAACGGGGAGACTGAGG + Intergenic
1160844315 19:1159791-1159813 GGGGAACAGCGGGGGGACAGTGG + Intronic
1160928227 19:1557017-1557039 GGGCACAGGCTGGGAGGTAGGGG - Intronic
1161430382 19:4229150-4229172 AGGGACATGGAGGGAGACAGAGG - Intergenic
1161779872 19:6284702-6284724 AGGGACAAAATGGGAGTCAGGGG + Intergenic
1161920188 19:7260296-7260318 CGGGACATGCTGGGTGCCAGGGG - Intronic
1162080080 19:8212532-8212554 GGTGGCAAGCTGGGAGCCAAGGG + Intronic
1162303597 19:9858057-9858079 GTGGACCAGATGGGAGCCAGTGG - Intronic
1162346194 19:10119445-10119467 GGGGAACAGCTGGGAGGCAGTGG + Intronic
1162732852 19:12729315-12729337 GGGTAGAACCTGGGAGACTGAGG - Intergenic
1162897627 19:13774826-13774848 GGGGACGAGCTAGGAGCGAGGGG + Intronic
1162972784 19:14191151-14191173 GGAGACAAGGCGGGAGTCAGAGG - Intronic
1165058478 19:33193992-33194014 TGGGAAAAGGTGGGAGAGAGAGG - Intronic
1165789956 19:38485409-38485431 TGGGAGAAGATGGGAGACAGAGG - Intronic
1165816394 19:38645041-38645063 GAGGGGGAGCTGGGAGACAGTGG + Intergenic
1165886968 19:39085222-39085244 GGGGAAAAGCAGGGGGACTGAGG - Exonic
1166212630 19:41316844-41316866 GGGGGCCAGATGGGCGACAGTGG + Intronic
1166270197 19:41708803-41708825 GAGGACAACCTGGGAGAGGGTGG + Intronic
1166631631 19:44412107-44412129 AGAGAGAAGCTGGGAGACACAGG - Intergenic
1166636545 19:44456514-44456536 AGAGAGAAGCTGGGAGACACAGG + Intergenic
1166636881 19:44458422-44458444 GGGGAGTAGCTGGGAGACACGGG + Intergenic
1166638619 19:44473999-44474021 GGAGAGGAGCTGGGAGACACAGG + Intergenic
1167050145 19:47072899-47072921 GGGGACCAGCTGGTAGAGGGGGG + Intronic
1167209320 19:48123105-48123127 GGGGACAGGCTGGGAGGCCGGGG + Intronic
1167368641 19:49067681-49067703 GGGGACAAGCTGTGAGACCTTGG + Exonic
1167609006 19:50497216-50497238 GGGGCCGAGCTGAGAGGCAGAGG + Intergenic
1167706427 19:51083921-51083943 CGGGACATGGTGGGAGAAAGAGG + Intronic
1168021051 19:53608869-53608891 GGTGTGAAGCTGGGAGGCAGAGG + Intergenic
1168063042 19:53904751-53904773 CTGGAGAAGCTGGGAGTCAGGGG - Intronic
1202648613 1_KI270706v1_random:161536-161558 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1202648952 1_KI270706v1_random:163443-163465 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1202649307 1_KI270706v1_random:166146-166168 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1202703208 1_KI270713v1_random:3518-3540 AGGGGCAGGGTGGGAGACAGGGG + Intergenic
1202703844 1_KI270713v1_random:6284-6306 CAGGACAAGCTGGGAGCCTGAGG - Intergenic
925440769 2:3883350-3883372 GGGGCCAATCTCGGAGAAAGTGG - Intergenic
925611570 2:5706374-5706396 GTGGAGAAGCTGGGAGGCTGGGG + Intergenic
925611599 2:5706462-5706484 GTGGAGAAGCTGGGAGGCTGGGG + Intergenic
926028401 2:9564764-9564786 GGGGTGAACCTGGGAGGCAGAGG - Intergenic
926134239 2:10325503-10325525 GGGGACAAGCAGAGAGGCACAGG - Intronic
926163305 2:10502840-10502862 GGAGAGAAGCTTGGGGACAGCGG - Intergenic
928001446 2:27526352-27526374 TGGGACCAGGTAGGAGACAGAGG + Intergenic
930031538 2:47061030-47061052 GGGGACAAGGAGGGACAAAGCGG - Intronic
930185824 2:48411093-48411115 GAGGACAAGCTGTGAGAGGGAGG + Intergenic
930732815 2:54744584-54744606 GGGGAGCAGGAGGGAGACAGTGG + Intronic
931992999 2:67809678-67809700 GGGGAAAAGCTGGCAGTCACAGG - Intergenic
932417907 2:71584739-71584761 GGGGAGAAGCTGGGAGAGGCTGG + Intronic
932440413 2:71731264-71731286 GGAGAGTAGCCGGGAGACAGAGG - Intergenic
932766792 2:74475509-74475531 GAGGACAAGGATGGAGACAGTGG + Intronic
933277094 2:80295394-80295416 GTGGACATGCTGGAAAACAGAGG - Intronic
933345863 2:81084976-81084998 GGGGACCAACTGTGATACAGAGG + Intergenic
933911265 2:86942884-86942906 GGGAACAAACCGGGAGAAAGAGG - Intronic
934561858 2:95317623-95317645 GGGGACAAGCTGAGACCAAGAGG + Intronic
934573138 2:95384563-95384585 AGGGACCAGCTGGGGGGCAGGGG + Exonic
934745305 2:96755839-96755861 GGGGATTACCTGGGAGGCAGAGG - Intergenic
934890145 2:98060430-98060452 TAGGAGGAGCTGGGAGACAGGGG + Intergenic
935775094 2:106466171-106466193 GGGAACAAGCCGGGAGAAAGAGG + Intronic
935904975 2:107829725-107829747 GGGAACAAGCCGGGAGAAAGAGG - Intronic
935991135 2:108719894-108719916 GGGAACAAGCCGGGAGAAAGAGG - Intronic
936154229 2:110037678-110037700 GAGGGGAAGCTGGGGGACAGTGG - Intergenic
936190455 2:110333737-110333759 GAGGGGAAGCTGGGGGACAGTGG + Intergenic
936415974 2:112312295-112312317 GGGGACAAGAAGGGAGGCAGTGG + Intronic
936427282 2:112432763-112432785 GGGAACAAACCGGGAGAAAGAGG + Intronic
937076995 2:119114285-119114307 GGGGAGCATCTGGGAGACAGCGG - Intergenic
937223514 2:120355401-120355423 GGGGTCTACCTGGAAGACAGGGG + Intergenic
937298850 2:120826209-120826231 GGGGAGAAGCTGAGACAGAGAGG + Intronic
937728589 2:125198054-125198076 GGGGACATGATAAGAGACAGAGG + Intergenic
937917901 2:127107879-127107901 GTGGAGCACCTGGGAGACAGAGG - Intergenic
938499370 2:131822396-131822418 GGGGTCAGGCTGGGGGACATGGG + Intergenic
938540860 2:132282423-132282445 GGAGAGTAGCTGGGAGACACGGG + Intergenic
938541376 2:132286568-132286590 GGAGAGAAGCTGGGAGACACAGG + Intergenic
938541680 2:132288326-132288348 GGAGAGTAGCTGGGAGACACGGG + Intergenic
938592740 2:132755179-132755201 GAGGACAATCTGGGAGGAAGAGG + Intronic
941099629 2:161281926-161281948 GGAGAGTAGCTGGGAGACACAGG - Intergenic
941099658 2:161282073-161282095 GGAGAGAAGCTGGGAGACACAGG - Intergenic
941848794 2:170158671-170158693 GGGTATAAGCTGGCAAACAGTGG - Intergenic
942043688 2:172086980-172087002 GGAGACACGCTGAGAGCCAGGGG - Intronic
943016018 2:182511726-182511748 GGGGAGAGGCTGGCAAACAGGGG - Intronic
943878215 2:193102057-193102079 GGGGACCAGCCTGGAGCCAGGGG + Intergenic
943912150 2:193583277-193583299 GGGGAGAAGCCAGGAGACAATGG + Intergenic
946068736 2:217012725-217012747 GGGGGAAAGCTGGGGGACGGAGG - Intergenic
946396252 2:219445063-219445085 GGGCGCAAGCTGGGGGTCAGAGG + Exonic
946418899 2:219553933-219553955 GGGGAGAAGCTGGGGGCCAGAGG + Intronic
947375770 2:229493558-229493580 AGGGAGAAGCTGAGGGACAGAGG + Intronic
947691578 2:232141739-232141761 GGTGAAAAGCTAGGAGACAAAGG - Intronic
947968216 2:234300130-234300152 TGGGACCATCTTGGAGACAGGGG - Intergenic
948102509 2:235386175-235386197 TGGCATAACCTGGGAGACAGAGG - Intergenic
948208517 2:236175868-236175890 GAGGGAGAGCTGGGAGACAGAGG - Intergenic
948407467 2:237733157-237733179 AGGGACAGGCTGGGACACAAGGG - Intronic
948685872 2:239669556-239669578 AGGAAGGAGCTGGGAGACAGAGG - Intergenic
1169074301 20:2751897-2751919 GGGGACAGGGGGAGAGACAGCGG - Intronic
1169083649 20:2814140-2814162 GGTGGCAAAATGGGAGACAGTGG - Intergenic
1170069875 20:12354884-12354906 GGGTCCAATCTGAGAGACAGGGG - Intergenic
1170721040 20:18879411-18879433 GGGGAAAAGCTGGCAGTCACAGG + Intergenic
1170821076 20:19756911-19756933 GGGGAAGAAGTGGGAGACAGAGG - Intergenic
1171463266 20:25310601-25310623 AGGGCCAGGCTGGGAGGCAGGGG + Intronic
1171869767 20:30515424-30515446 GGAGAGTAGCTGGGAGACACGGG + Intergenic
1171870277 20:30519590-30519612 GGAGAGGAGCTGGGAGACACAGG + Intergenic
1171870553 20:30521202-30521224 GGAGAGTAGCTGGGAGACACGGG + Intergenic
1172451970 20:35032553-35032575 GGCGAGAACCTGGGAGGCAGAGG - Intronic
1173468300 20:43301962-43301984 GGGGACCAGCTCTGAGTCAGTGG - Intergenic
1173844702 20:46180497-46180519 GAGGGCAAGATGGGAGAAAGAGG + Intronic
1174058320 20:47815016-47815038 TGGGACAAGCTGGGAGTAAGAGG + Intergenic
1174526955 20:51180144-51180166 GGGGAGTAGCTGGGAGAGTGGGG - Intergenic
1174929343 20:54795229-54795251 GGGGAGAGGCACGGAGACAGGGG - Intergenic
1175597381 20:60246237-60246259 GTGGACATGCTTGGATACAGAGG + Intergenic
1176457862 21:6928990-6929012 GGAGCCAAGCTGGGCGTCAGGGG - Intergenic
1176602514 21:8806400-8806422 GGAGAGTAGCTGGGAGACAAAGG + Intergenic
1176602867 21:8809099-8809121 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1176603240 21:8811151-8811173 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1176611835 21:8990935-8990957 GGAGAGTAGCTGGGAGACAGAGG - Intergenic
1176836034 21:13794074-13794096 GGAGCCAAGCTGGGCGTCAGGGG - Intergenic
1176972134 21:15278905-15278927 GTTCACAAGCTTGGAGACAGTGG - Intergenic
1177576283 21:22960422-22960444 GCCGACAAGCTGGGAGACTGAGG + Intergenic
1178487287 21:33027061-33027083 GGGGACAAGCTAGGAGGCAGTGG + Exonic
1178843761 21:36157418-36157440 GGGGACTGGCTGGAAGACTGGGG - Intronic
1179157838 21:38865411-38865433 AGGAACATGCTGGGAGACAGAGG + Intergenic
1179345795 21:40555962-40555984 GAGGACAAGTTGGGTGAGAGAGG + Intronic
1179512262 21:41880862-41880884 GGGGACAAGCAGGGAGACAGTGG - Intergenic
1179807028 21:43845928-43845950 GAGGACAAGCTGGTGGCCAGGGG + Intergenic
1179911135 21:44449578-44449600 TGGGACAGGCTGGGAGCCAGGGG + Intergenic
1180095961 21:45555381-45555403 GGGGACAGTATGGGAGGCAGGGG + Intergenic
1180344799 22:11697953-11697975 GGAGAGTAGCTGGGAGACAAAGG + Intergenic
1180345152 22:11700656-11700678 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1180345526 22:11702708-11702730 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1180352192 22:11814604-11814626 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1180353289 22:11820949-11820971 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1180384951 22:12171408-12171430 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1180386015 22:12177462-12177484 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1181546177 22:23603799-23603821 GGGGCCAGGCTGGGGGACACAGG - Intergenic
1181937491 22:26449246-26449268 GGGGATAAGCTGGGCAACAGTGG - Intronic
1182149615 22:28018805-28018827 GGTGTCAAGCTGGGACTCAGAGG + Intronic
1182743077 22:32582996-32583018 GGGGTGAAGCTGGAAGACAAAGG - Intronic
1183329342 22:37211205-37211227 GAGGACAAGCAGAGAGCCAGGGG - Intronic
1183654568 22:39177194-39177216 GGGGAGAAGCTGGGAGCTGGAGG + Intergenic
1184190886 22:42893622-42893644 GAGAACCAGCTGGGAGGCAGGGG + Intronic
1184413500 22:44338981-44339003 GAGGAGGAGCTGGGAGACTGTGG - Intergenic
1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG + Intronic
1185045940 22:48528809-48528831 GGGGAGAAGCTGGGGGTCTGTGG + Intronic
1185124981 22:49004935-49004957 GTGGACAGGGTGGCAGACAGGGG + Intergenic
1185413707 22:50698557-50698579 GGGAAAAAGCTGGGAGAAAGTGG + Intergenic
950704767 3:14772952-14772974 GAGGACAGGGTGGGAGACCGGGG - Exonic
952342785 3:32459632-32459654 GGGGAGGAGCAGGGAGCCAGGGG + Intronic
952549209 3:34457028-34457050 GTGGACAACTTGGGAGCCAGAGG - Intergenic
953031969 3:39185385-39185407 GAGGAAAAGCTGGGAGATAGAGG + Exonic
953782892 3:45886943-45886965 GGGGACAAGATGGTGGCCAGGGG + Intronic
954135117 3:48578888-48578910 GGGGAGATGCTGGGACAGAGGGG - Intronic
954297984 3:49684752-49684774 CAGGACAAGCTGGGAGCCTGAGG + Exonic
954298622 3:49687517-49687539 AGGGGCAGGGTGGGAGACAGGGG - Intronic
954380831 3:50218220-50218242 GGTGACAAGCTGGGTAACATTGG - Intronic
954404343 3:50337159-50337181 CGGGACCAGGTGGGAGCCAGGGG - Intronic
954446440 3:50549406-50549428 GGGGAGGAGCTGGGGGAGAGAGG + Intergenic
954618808 3:51984232-51984254 GGGGCTCAGCTGGGTGACAGGGG - Intronic
954964388 3:54597413-54597435 GGGGTGAAGGTGGGAGAGAGAGG - Intronic
957387804 3:79519543-79519565 GGCGTGAACCTGGGAGACAGAGG + Intronic
958114781 3:89201603-89201625 GGTGAATAGCTGCGAGACAGTGG - Intronic
959373996 3:105564944-105564966 GCTGAGAACCTGGGAGACAGAGG + Intronic
959908781 3:111739663-111739685 AGGGAGAGGCAGGGAGACAGGGG - Intronic
960227275 3:115183551-115183573 AGGGACTAGCTGGGAGGCTGAGG + Intergenic
961474277 3:127136968-127136990 GAGGATGAGCTGGGGGACAGAGG - Intergenic
961552826 3:127678897-127678919 GGAAGCATGCTGGGAGACAGAGG + Intronic
962292270 3:134146681-134146703 GGGCAGGAGCTGGGAGATAGGGG - Intronic
962731789 3:138290219-138290241 GTGGTGAAGCTGGGAGTCAGTGG + Intronic
963401246 3:144802324-144802346 CAGGAGAAGCTGGCAGACAGGGG + Intergenic
964808188 3:160634524-160634546 GAGGGCAAGCTGGGAGAGAAGGG - Intergenic
965384210 3:168026501-168026523 GGGAACATGCTGGGAAACATTGG - Intronic
966045135 3:175539650-175539672 GGGGTCAAGGGGGAAGACAGTGG - Intronic
966174091 3:177116308-177116330 GGTGACAAGTTGGGTGAAAGTGG - Intronic
967118164 3:186360801-186360823 GGGGTCATGATGAGAGACAGTGG - Intronic
967889974 3:194358080-194358102 GTGGACAGGATGGGAGACTGTGG - Exonic
968941317 4:3640285-3640307 GGGAAGAGGCTGGAAGACAGCGG + Intergenic
969495089 4:7521934-7521956 GGGGACAAGCTGGAGCACACCGG + Intronic
970344879 4:15143759-15143781 GGTGGCAAGCTGAGAGATAGGGG + Intergenic
972806443 4:42533366-42533388 GGGGAAAAGCTGGCAGCCACAGG - Intronic
973374838 4:49279500-49279522 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973375162 4:49281261-49281283 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973375742 4:49285522-49285544 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973376062 4:49287283-49287305 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973376641 4:49291541-49291563 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973376985 4:49293446-49293468 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973377560 4:49297693-49297715 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973378479 4:49303829-49303851 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973378848 4:49305881-49305903 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973379370 4:49309773-49309795 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973379682 4:49311534-49311556 GGAGAGAAGCTGGGAGACACAGG - Intergenic
973380241 4:49315769-49315791 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973380583 4:49317674-49317696 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
973381161 4:49321935-49321957 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973381668 4:49324719-49324741 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
973382249 4:49328980-49329002 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973382573 4:49330741-49330763 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
973385784 4:49513592-49513614 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973386186 4:49515790-49515812 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
975296341 4:72738569-72738591 TGGGAGAGGCTGGTAGACAGAGG - Intergenic
976053291 4:81032285-81032307 TGGGAGGAGCTGGGAGACAAGGG + Intronic
978047498 4:104149554-104149576 GGGGAAGAGCAGGGAGAAAGAGG + Intergenic
979200982 4:117977729-117977751 TGGGAGAGGCTGGCAGACAGAGG - Intergenic
980368158 4:131832914-131832936 GGGCACAGGATGGGGGACAGGGG + Intergenic
982202434 4:152973635-152973657 GGGGACGAGGTGGGAGGCTGAGG + Intronic
982720261 4:158852283-158852305 AGGGACAAGCTGAGAAACTGAGG + Intronic
985261004 4:188114731-188114753 GGTGAGAACCTGGGAGGCAGAGG + Intergenic
985472008 5:52572-52594 GGGGACAGTCAGGGCGACAGGGG + Intergenic
985705587 5:1399825-1399847 GGGAACAGGCCGGGAGGCAGTGG - Intronic
985929709 5:3047350-3047372 GGGGTCCAGCAGGGAGCCAGTGG + Intergenic
985999455 5:3619204-3619226 AGGGGACAGCTGGGAGACAGAGG - Intergenic
986550212 5:8945392-8945414 GGGGAGAGGTGGGGAGACAGGGG - Intergenic
987187729 5:15442635-15442657 GGGAACAAACTTGGAGGCAGAGG - Intergenic
987908066 5:24105197-24105219 GGGGACTGGCTGTGAGACATGGG - Intronic
988832482 5:35001411-35001433 GGGGACAAGACTGGAGACAGGGG - Intronic
988961347 5:36374645-36374667 GAGGTCCAGCTGGGAGCCAGAGG + Intergenic
989414720 5:41160359-41160381 GGGGGCAAGCTAGGAGAAAATGG + Exonic
990134694 5:52631197-52631219 TGGGAGAAGCTGGCAGACAAGGG + Intergenic
991010821 5:61881487-61881509 GGGGATAAGCTAGGAATCAGAGG - Intergenic
991998640 5:72413636-72413658 GGGCAGAAGCTGGAAGACATGGG + Intergenic
992258480 5:74946173-74946195 TGGGTCAAGCCGGGAGTCAGAGG + Intergenic
993883898 5:93394872-93394894 GGGGAAAAGCTGGCAGTCACAGG + Intergenic
994539976 5:101081980-101082002 AGGGACAAGGTGTGAGAGAGGGG + Intergenic
996263584 5:121505915-121505937 GGGGAAAAGGTGGGAGGGAGGGG + Intergenic
996743947 5:126829255-126829277 GGGGACATGCTGTGAGCCACTGG - Intronic
997105997 5:131019853-131019875 GGGGAAAAGCTGGCAGTCACAGG + Intergenic
997304861 5:132829825-132829847 GCGGACAGGCTGGGAGAACGGGG - Intronic
997388947 5:133497588-133497610 GGGGTCACGCAGGCAGACAGGGG + Intronic
997507900 5:134432806-134432828 GTGGAACTGCTGGGAGACAGAGG - Intergenic
997584291 5:135035270-135035292 GGAGAGAAGCTGGAAGACTGAGG - Intronic
997963366 5:138338639-138338661 GGGGACAGGCAGGGCAACAGAGG + Intronic
998777503 5:145618961-145618983 GGGGAAAAGCTGGCAGTCACAGG + Intronic
998940847 5:147280502-147280524 GGGGAAAAGCTGGCAGTCACAGG - Intronic
999151712 5:149430635-149430657 GAGGACAAGGTGGGAGCGAGTGG - Intergenic
999201037 5:149816556-149816578 GTGAACAATCTGGGAGGCAGAGG - Intronic
1000284655 5:159816594-159816616 GGGCACAAGGTGGGAGCAAGAGG + Intergenic
1001098792 5:168796916-168796938 GGGGGAAAGCAGGGAGAAAGGGG + Intronic
1001104847 5:168844190-168844212 GCGGGCACACTGGGAGACAGGGG - Intronic
1001130350 5:169058476-169058498 TGGGAGAAGCTGGGGAACAGGGG + Intronic
1001175837 5:169468127-169468149 ATGGACAGGCTGGGAGAGAGCGG + Intergenic
1001598186 5:172911873-172911895 TGGGACAAGAAGGGGGACAGGGG - Intronic
1001936544 5:175709656-175709678 GGGGAGAAGCCAGCAGACAGTGG - Intergenic
1002136005 5:177107961-177107983 GGGGACAACATGGGAGACAAGGG + Intergenic
1002212353 5:177606554-177606576 GGAGACCAGCTGGGAGACTATGG - Intronic
1002348822 5:178567645-178567667 AGGCACAAACTGGGAGACGGAGG + Intronic
1002375903 5:178788985-178789007 GGGCAGAAGCTGGGAGACTCAGG - Intergenic
1002445755 5:179288833-179288855 GGTGTCACACTGGGAGACAGTGG + Intronic
1002613695 5:180437305-180437327 GGGGACAAGCTGGGACCTTGGGG - Intergenic
1004393364 6:15227607-15227629 GGGGACAAGCGGGGTGGGAGTGG + Intergenic
1004851903 6:19708050-19708072 GGAGACCAGCTGGGACTCAGTGG + Intergenic
1005155803 6:22804780-22804802 GGGGAGAAGATGGGATTCAGAGG + Intergenic
1006375585 6:33670053-33670075 AGGGAAAGGGTGGGAGACAGGGG - Intronic
1006464347 6:34182852-34182874 TGAGAGAAGGTGGGAGACAGGGG - Intergenic
1006734381 6:36262223-36262245 TGGGACGAGGTGGGGGACAGGGG - Intronic
1006877978 6:37315067-37315089 GGGGATAAGCTGGCTGCCAGAGG + Intronic
1007119678 6:39369584-39369606 GGGGACAACCTTGGACAGAGAGG - Intronic
1007750658 6:44068750-44068772 GGTGACTTGCTGGAAGACAGAGG - Intergenic
1008714026 6:54266598-54266620 GGTGACAGGCAGAGAGACAGTGG - Intergenic
1010518493 6:76803364-76803386 GGGGAAAAGCTGGCAGTCACAGG + Intergenic
1010817553 6:80376284-80376306 GGGGGAAAGCTGGCAGACACAGG + Intergenic
1011755887 6:90497859-90497881 GGGTACAAGCTCAGAGTCAGAGG + Intergenic
1012024464 6:93971076-93971098 AGAGACAAGGTGAGAGACAGAGG + Intergenic
1012282955 6:97350949-97350971 GGAGACAAGCAGAGAAACAGAGG + Intergenic
1012534306 6:100277502-100277524 AGGGACAATATGGGAGGCAGTGG + Intergenic
1013479615 6:110542858-110542880 AGGGAGAAGCTGGAGGACAGAGG - Intergenic
1014051759 6:116963219-116963241 GGAGACAAACTGGGAGACTCAGG - Intergenic
1016262740 6:142192614-142192636 GGGGACAAGGGGTGAGAAAGAGG - Intronic
1017076897 6:150626980-150627002 TGGGACATGCTGGGAAAAAGGGG + Intronic
1017652636 6:156597356-156597378 GCCGGCAAGCTGGGGGACAGGGG - Intergenic
1018098287 6:160412684-160412706 GAGTGCAAGCTGGGAAACAGGGG - Intronic
1018762757 6:166905718-166905740 GGGGAGAAGCAGTGAGCCAGGGG - Intronic
1018849212 6:167575668-167575690 GGGGCCAAGGTGGGAGAGGGTGG + Intergenic
1018849221 6:167575689-167575711 GGGGCCAAGGTGGGAGAGGGTGG + Intergenic
1018849238 6:167575731-167575753 GGGGCCAAGGTGGGAGAGGGTGG + Intergenic
1018849247 6:167575752-167575774 GGGGCCAAGGTGGGAGAGGGTGG + Intergenic
1018849287 6:167575857-167575879 GGGGCCAAGGTGGGAGAGGGTGG + Intergenic
1018893182 6:167996746-167996768 GGGGACAACAGGGGGGACAGCGG + Intronic
1019171496 6:170135820-170135842 GGGGAGGAGCTGGCAGAGAGTGG - Intergenic
1019299698 7:296871-296893 GAGGAGAAGCTGGGAGGGAGTGG + Intergenic
1019299734 7:296993-297015 GAGGAGAAGCTGGGAGGGAGTGG + Intergenic
1019299770 7:297115-297137 GAGGAGAAGCTGGGAGGGAGTGG + Intergenic
1019299788 7:297176-297198 GAGGAGAAGCTGGGAGGGAGTGG + Intergenic
1019399146 7:841325-841347 GGAGTGAACCTGGGAGACAGAGG - Intronic
1019577426 7:1744252-1744274 GGGGACAAGAGAGAAGACAGCGG - Intronic
1020049452 7:5072333-5072355 GGGGACAAGGTGGGCGTTAGGGG - Intronic
1020118911 7:5491942-5491964 GGCGAGAATCTGGGAGGCAGGGG + Intronic
1020260324 7:6527159-6527181 AGAGACGAGGTGGGAGACAGTGG - Intronic
1021163139 7:17299470-17299492 GGAGGCCGGCTGGGAGACAGAGG + Intronic
1022770208 7:33462983-33463005 AGGGACAAGCTAGGAGAAAATGG + Intronic
1023859389 7:44208407-44208429 GGGACCAAGCTGGGAACCAGTGG + Intronic
1023986453 7:45099961-45099983 GGGAAGAAGCTGGGAGAGACAGG + Intergenic
1023995604 7:45157556-45157578 GGGGACAAGCTGGGGTAAGGTGG - Intergenic
1025804537 7:64818074-64818096 AAGGAGAACCTGGGAGACAGAGG - Intronic
1026503245 7:70960513-70960535 TGGGAGGAGCTGGGATACAGAGG + Intergenic
1026554516 7:71394576-71394598 GATGACCATCTGGGAGACAGAGG - Intronic
1027978462 7:85186865-85186887 GGGGCCAGGCCGGGAGGCAGGGG + Intergenic
1028439708 7:90846058-90846080 GGGGACAAAGTTGGAGACAAAGG - Intronic
1029686871 7:102154579-102154601 GGAGACAAGCTGGAGTACAGTGG - Intronic
1029921413 7:104268714-104268736 GGGGAAGAGCTGGGAGAGAAAGG - Intergenic
1030095646 7:105896839-105896861 GGGGCCAGCCTGGGAAACAGAGG - Intronic
1032097631 7:128947460-128947482 GGGGGCAGGCTGGCAGGCAGGGG - Exonic
1033556666 7:142494026-142494048 GTGGACAAGCTGTGACACTGAGG + Intergenic
1034275718 7:149823005-149823027 GGGGCAGAGATGGGAGACAGAGG - Intergenic
1034292540 7:149944502-149944524 AGAGTCAGGCTGGGAGACAGAGG + Intergenic
1034698297 7:153074303-153074325 GGGGAAAAATTGGGAGACTGGGG + Intergenic
1034813530 7:154152390-154152412 AGAGTCAGGCTGGGAGACAGAGG - Intronic
1034887179 7:154806839-154806861 GGGCTCCAGCAGGGAGACAGAGG + Intronic
1034978856 7:155463220-155463242 GGGGACCTGGTGGGAGAGAGGGG + Exonic
1035034603 7:155886648-155886670 GAGGGCAAGCTGGGAGCCTGGGG + Intergenic
1035443805 7:158925802-158925824 GGGAAGGAGCTGGGAGGCAGAGG - Intronic
1036419972 8:8586369-8586391 GGGGAAAACATGGCAGACAGAGG - Intergenic
1036575474 8:10023862-10023884 GAGGACAAGCAGGGACACAGTGG - Intergenic
1038672101 8:29590906-29590928 TGGGAGAAGGTGGGATACAGTGG + Intergenic
1039431252 8:37526827-37526849 GGGAACCAGCTGGGAGTCTGTGG + Intergenic
1039491629 8:37952050-37952072 GGGGAGATGCTGGCAGGCAGGGG + Intergenic
1040290321 8:46120882-46120904 GGGGAGAAGCGGCAAGACAGTGG - Intergenic
1040509868 8:48084339-48084361 GGAGAGGAGCTGGGAGACATGGG + Intergenic
1040509960 8:48084773-48084795 GGGGAGTAGCTGGGAGAGACAGG + Intergenic
1040560981 8:48523341-48523363 GGCTACAGGCTGGGAGCCAGCGG + Intergenic
1040834525 8:51718277-51718299 GGGGAGGAGCTGGGAGATTGTGG + Intronic
1041020525 8:53633718-53633740 GAGCACAGGCAGGGAGACAGAGG - Intergenic
1041080743 8:54212699-54212721 GGGGACAAGCTTGAAGACCAAGG + Intergenic
1042258335 8:66829954-66829976 AGGGAGAACCTGGGAGGCAGAGG - Intronic
1042591909 8:70404168-70404190 GGGGACAAAATGGGTGACTGTGG + Intergenic
1042768445 8:72352779-72352801 GGGGAAAAGCTGGTAGCCATAGG + Intergenic
1045007267 8:97927539-97927561 AGGGACAAGCTATGAGACTGTGG + Intronic
1046017086 8:108617905-108617927 GGACACAAGCTGGGAGAATGGGG - Intronic
1046486375 8:114894083-114894105 GGGTCCAAGCTGGGGGGCAGGGG + Intergenic
1046521793 8:115334485-115334507 GTGAACAAGCTGGGAGAGTGAGG - Intergenic
1047470512 8:125167040-125167062 GGAGATGAGGTGGGAGACAGTGG - Intronic
1047904696 8:129460387-129460409 GGGGATAAGCTGTGGGGCAGGGG - Intergenic
1048186013 8:132241479-132241501 TAGGAGAACCTGGGAGACAGAGG - Intronic
1049264409 8:141659759-141659781 GTTGACAAGCGGGGAGAGAGAGG - Intergenic
1049358587 8:142200990-142201012 GGGGAAGGGCTGCGAGACAGAGG + Intergenic
1049434756 8:142581363-142581385 TGGGACAAGCGGGGAGACCCAGG - Intergenic
1049906927 9:226472-226494 GGAAACCAGCTGGGAGGCAGTGG + Intronic
1051060949 9:13044468-13044490 GGGGAGAAGTTGGGGTACAGTGG - Intergenic
1051154313 9:14123772-14123794 AGGGGCAAACTGGGAGGCAGAGG - Intronic
1051154340 9:14123872-14123894 AGGGGCAACCTGGGAGGCAGAGG - Intronic
1051291952 9:15553525-15553547 GGGGACCAGAGGGGAGGCAGAGG + Intronic
1052352667 9:27473338-27473360 GGGGTCGTGCTGGGACACAGAGG + Intronic
1052773147 9:32707791-32707813 GGAGTCAAGTTGGGAGACACAGG + Intergenic
1053148353 9:35727239-35727261 GGGGAAAAGCAGGGTGAGAGGGG + Intronic
1053279553 9:36809491-36809513 GGGGACAGGCTGAGTGACCGGGG + Intergenic
1053428137 9:38024559-38024581 GGGGTGAAGCTGGAAGACAGTGG - Intronic
1053632514 9:39958617-39958639 GGGCACAGGATGGGGGACAGGGG + Intergenic
1053773246 9:41504914-41504936 GGGCACAGGATGGGGGACAGGGG - Intergenic
1054211374 9:62292080-62292102 GGGCACAGGATGGGGGACAGGGG - Intergenic
1054313609 9:63556772-63556794 GGGCACAGGATGGGGGACAGGGG + Intergenic
1054738239 9:68778548-68778570 GGGGAGAAGCAGAGAGACTGAGG - Intronic
1054867792 9:70020428-70020450 GGGGAAAAGCTGGCAGTCACAGG + Intergenic
1055768548 9:79691562-79691584 GGGGTGATGCTGGGAGAAAGGGG - Intronic
1056311746 9:85347836-85347858 AGGGACCGGCTGGGAGACACAGG - Intergenic
1056396583 9:86186862-86186884 GAGGAAAAGCTGGCAGTCAGAGG - Intergenic
1056787856 9:89605547-89605569 CGGCCCAGGCTGGGAGACAGGGG + Intronic
1057189665 9:93079622-93079644 GGGGACATGCTGGGGGACAAGGG + Intronic
1057890223 9:98864340-98864362 GGGGCCAAGCTGGGAGCCTGGGG + Intergenic
1058654337 9:107206165-107206187 GGGGACAGGCTCGGAGGGAGGGG + Intergenic
1058740670 9:107939247-107939269 GGGGAGAAGAGGGGAGACTGGGG + Intergenic
1059549453 9:115214249-115214271 GGGGACAAGCTGTGAGCAAGGGG + Intronic
1059762894 9:117355816-117355838 GGGGCCATGCTGGGGGACATGGG + Intronic
1060104599 9:120865900-120865922 GGGTCCAGGCTGAGAGACAGGGG + Intronic
1060148242 9:121269556-121269578 GGGGAGAGGCTTGGAAACAGAGG + Intronic
1060180720 9:121531811-121531833 GGAGACCAGCTGGGAGACTGAGG + Intergenic
1060190905 9:121591916-121591938 GGGGACAAACTGGGAGAGTATGG + Intronic
1060265229 9:122108222-122108244 GGAGACAGGATGGGAGAGAGAGG + Intergenic
1060402226 9:123355731-123355753 GGGGACGAGCTGGGTGGGAGGGG + Intergenic
1060764221 9:126281860-126281882 GGGGTCAGCCTGGGAGGCAGGGG - Intergenic
1060766519 9:126298190-126298212 GGGGGCAAGCTGGGGCCCAGAGG + Intergenic
1061080718 9:128368357-128368379 AGGCACAAGCTGGGAGGCGGAGG - Intergenic
1061375641 9:130222894-130222916 AGGCACAAGCTGGTAGATAGTGG + Intronic
1061488088 9:130930406-130930428 GGGGAGACGCGGGGAGACACGGG + Intronic
1061609368 9:131736302-131736324 AGGAACAAGCTGGGATGCAGGGG - Intronic
1061657007 9:132099913-132099935 GGGGACAGTCAGGGAGGCAGAGG + Intergenic
1061914661 9:133743191-133743213 GGGGACTAGCAGGCAGATAGGGG + Intergenic
1061980132 9:134097770-134097792 GGGGTGAACCTGGGAGGCAGTGG + Intergenic
1062018488 9:134304415-134304437 GGGGTCCAGCTGGGAGACCAGGG - Intergenic
1062037321 9:134388539-134388561 GAGGACAAGCAGTCAGACAGAGG - Intronic
1062200550 9:135300583-135300605 GGGGACAAGGTGGGTGCCAGGGG + Intergenic
1062287050 9:135777964-135777986 ATGGAGGAGCTGGGAGACAGAGG - Intronic
1062291080 9:135794629-135794651 TGGGCAAAGCTGGGAGCCAGGGG + Intergenic
1062542906 9:137049403-137049425 GGGGACAGGCGGCGAGCCAGCGG - Intronic
1203698548 Un_GL000214v1:117605-117627 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203698879 Un_GL000214v1:119510-119532 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203699467 Un_GL000214v1:123756-123778 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203699836 Un_GL000214v1:125808-125830 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203700413 Un_GL000214v1:130039-130061 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203700738 Un_GL000214v1:131800-131822 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203701328 Un_GL000214v1:136059-136081 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203479572 Un_GL000224v1:398-420 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203480158 Un_GL000224v1:4642-4664 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203480539 Un_GL000224v1:6694-6716 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203481125 Un_GL000224v1:10970-10992 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203481506 Un_GL000224v1:13022-13044 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203482089 Un_GL000224v1:17279-17301 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203548654 Un_KI270743v1:150999-151021 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203549058 Un_KI270743v1:153195-153217 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203549392 Un_KI270743v1:155354-155376 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1203549763 Un_KI270743v1:157406-157428 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1203550350 Un_KI270743v1:161666-161688 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1203568119 Un_KI270744v1:108750-108772 GGAGAGAAGCTGGGAGGCACAGG + Intergenic
1203569176 Un_KI270744v1:115756-115778 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203569759 Un_KI270744v1:119993-120015 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203570125 Un_KI270744v1:122045-122067 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1186223014 X:7369572-7369594 AGGGCCAAGCTTGGAGGCAGAGG + Intergenic
1186602138 X:11049530-11049552 AGGTACAAGCTTGGACACAGTGG - Intergenic
1186681954 X:11884047-11884069 TGGGACAAGGTGGGATTCAGAGG + Intergenic
1186899025 X:14033338-14033360 GGGTCCCAGCTGGGGGACAGGGG - Intergenic
1187155894 X:16719994-16720016 GGGGCCGAGGTGGGAGGCAGGGG + Intronic
1187208080 X:17201768-17201790 GGGCCCCAGTTGGGAGACAGAGG + Intergenic
1188669297 X:32863424-32863446 GGAGAGAATCTGGGAGGCAGAGG + Intronic
1188991438 X:36825395-36825417 GGGGACTGGGTGGGAGATAGGGG + Intergenic
1189381972 X:40508503-40508525 GGGGACAAGCAGGGACTGAGTGG - Intergenic
1189639352 X:43051014-43051036 GGGGGAAAGCTGGTAGAGAGAGG + Intergenic
1193775944 X:85641888-85641910 GGGGAAAAGCTGGAAGCCACAGG + Intergenic
1194086212 X:89532030-89532052 GGGGACAAGCTGCAACACAAAGG + Intergenic
1195521644 X:105837438-105837460 GGAAACAAGCTGGAAGACATTGG - Intronic
1196903132 X:120406315-120406337 GGGGAGAATCTGGGAGACCAAGG - Intergenic
1197953678 X:131923762-131923784 GGGGGAAAGCTGGCAGTCAGAGG - Intergenic
1199590142 X:149460138-149460160 GGGGCCAATCTCTGAGACAGAGG - Intergenic
1199912105 X:152298015-152298037 TGGAACAAGCTGAGAGCCAGAGG + Intronic
1199966384 X:152824190-152824212 GGGGACAGGCAGGGAGACAGAGG - Intergenic
1200184887 X:154175785-154175807 GGGGACGTGCTTAGAGACAGAGG - Intergenic
1200190540 X:154212923-154212945 GGGGACGTGCTTAGAGACAGAGG - Intergenic
1200196291 X:154250725-154250747 GGGGACGTGCTTAGAGACAGAGG - Intergenic
1200201946 X:154287843-154287865 GGGGACGTGCTTAGAGACAGAGG - Exonic
1200438871 Y:3187907-3187929 GGGGACAAGCTGCAACACAAAGG + Intergenic