ID: 1131118897

View in Genome Browser
Species Human (GRCh38)
Location 15:89810957-89810979
Sequence ACTTGTGTCTCCAGGGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131118897_1131118908 22 Left 1131118897 15:89810957-89810979 CCACTTGCCCTGGAGACACAAGT 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1131118908 15:89811002-89811024 CCCTCCAAGTGCCTCCATGAGGG 0: 1
1: 0
2: 1
3: 11
4: 150
1131118897_1131118906 21 Left 1131118897 15:89810957-89810979 CCACTTGCCCTGGAGACACAAGT 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1131118906 15:89811001-89811023 GCCCTCCAAGTGCCTCCATGAGG 0: 1
1: 0
2: 2
3: 15
4: 222
1131118897_1131118901 -4 Left 1131118897 15:89810957-89810979 CCACTTGCCCTGGAGACACAAGT 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1131118901 15:89810976-89810998 AAGTCAGTGGTGCTGCCCCCAGG 0: 1
1: 0
2: 1
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131118897 Original CRISPR ACTTGTGTCTCCAGGGCAAG TGG (reversed) Intronic
900518389 1:3094117-3094139 ACCTGAGTGTGCAGGGCAAGAGG + Intronic
900623858 1:3599301-3599323 CCTTGTCTGTCCAGGGCAGGAGG + Intronic
900696715 1:4016862-4016884 ACTGTTGCCTCCAGGGCGAGGGG + Intergenic
902436771 1:16403146-16403168 CCACGTGTCTCCAGGGCAGGTGG - Intronic
902932614 1:19742131-19742153 ACTGGAATCTCAAGGGCAAGTGG - Intronic
903043668 1:20550897-20550919 ACATTTGTCTCCTGGGCCAGTGG - Intergenic
904611630 1:31729008-31729030 ACCTGTGTTTGCAGGACAAGTGG - Intronic
906091381 1:43182314-43182336 TATTGTGTCTCGAGGGCAAAAGG + Intronic
909176686 1:72370682-72370704 CTATGTGTTTCCAGGGCAAGAGG + Intergenic
909658070 1:78053028-78053050 ACTTGTTTTTCCAGGGCAGGGGG - Intronic
912361839 1:109101660-109101682 ACTTGTATCCCCAGGGCTAACGG + Intergenic
914329021 1:146648713-146648735 ACCTGGGTCTCCAGGACCAGTGG - Intergenic
918656071 1:187027759-187027781 ACTTGAGGCACCAGGGCCAGGGG - Intergenic
921047824 1:211490112-211490134 CGTTGTGCCTCAAGGGCAAGAGG + Intronic
921215042 1:212929341-212929363 ACTTTTGCCTCCAAGGGAAGTGG - Intergenic
921867710 1:220104080-220104102 ACTTGGGTGGCCAGGGCAGGAGG - Intronic
922650104 1:227330477-227330499 AAGTGTGTCATCAGGGCAAGTGG + Intergenic
923558238 1:235018777-235018799 AGTCCTGTCTCCAGGGTAAGGGG - Intergenic
1062833177 10:619598-619620 ACTAGTGTCACCTGTGCAAGGGG + Intronic
1067427256 10:46219763-46219785 ACTTGTGTCTCCTGGAAAAATGG + Intergenic
1067779262 10:49187398-49187420 TCTTGTGTCTCCAGACCAATAGG - Intronic
1068910368 10:62373684-62373706 AATTTTTTCTCCAGGGAAAGGGG + Intergenic
1071474884 10:86017609-86017631 CCTGGTGTCTCCAGGACAAGGGG + Intronic
1073388196 10:103146321-103146343 AATTGTGACTCCTAGGCAAGGGG - Intronic
1074001214 10:109375168-109375190 AGTTACGTCTCCAGGACAAGGGG + Intergenic
1074126937 10:110536087-110536109 ACTGGTGTCTCCAGGGAACTGGG - Intergenic
1074374379 10:112927217-112927239 TCTTGTGTCTGGAGGGCAATTGG + Intergenic
1076047614 10:127307413-127307435 ACTTGTGTGTCCAGTGTTAGAGG - Intronic
1076367085 10:129928078-129928100 TCTTGAGTTTGCAGGGCAAGTGG - Intronic
1078559586 11:12358958-12358980 AATTGTGTTTCCAGAGAAAGAGG + Exonic
1078858468 11:15225860-15225882 ACTTCTGTCTCCATGGCTATGGG - Intronic
1079157511 11:17962083-17962105 TCTTCTGACTCCAGGGCCAGTGG + Intronic
1082242393 11:49886945-49886967 GCTTGGGTCCCCAGGGTAAGAGG + Intergenic
1082892435 11:58154285-58154307 CCTTGTGTCTCCAGGCCACTGGG - Intronic
1084410044 11:69001652-69001674 ACCTGAGCCTCCAGGGCAACAGG + Intergenic
1088021305 11:105122985-105123007 ATTTGTCTCTGCAGGTCAAGGGG + Intergenic
1092389127 12:8059922-8059944 ACTTGGCTCTCCAGGGACAGTGG - Exonic
1099094636 12:78358492-78358514 ATGTGTTTCTCCAGGGCAAACGG + Intergenic
1099842019 12:87977719-87977741 ACTGGTGTCTCTATGACAAGGGG + Intergenic
1100362192 12:93889251-93889273 CCCTATGTCTCCAGGGCTAGTGG + Intronic
1101825781 12:108218951-108218973 ACTTATTTCCCCAGTGCAAGGGG - Intronic
1103481594 12:121253538-121253560 GCCTGTGTCTCCAGGCCATGTGG - Intronic
1110229543 13:73153875-73153897 AGTTGTGCCTCCAGAGCAAATGG + Intergenic
1110420261 13:75299612-75299634 ACTGTTGTCTCCAAGGCATGAGG - Intronic
1110790699 13:79583532-79583554 TCTTGTATATCCAGGGAAAGAGG - Intergenic
1114262083 14:21044356-21044378 CCTTATGTCTTCAGGCCAAGGGG - Intronic
1114767149 14:25386270-25386292 ACTTGTGTCTCTCAGGCACGTGG + Intergenic
1115207919 14:30932595-30932617 ACCTGTGTCTCCTGTGTAAGTGG - Intronic
1117524369 14:56582603-56582625 ACTTGAGCCCCCAGTGCAAGTGG + Intronic
1118824699 14:69369533-69369555 GCATGTGTCTTCAAGGCAAGCGG + Intergenic
1123036172 14:105472865-105472887 CCGTGTGTCTCCAGGGCACCTGG + Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1124890296 15:33726229-33726251 ACTTGTGGCCACAGGGAAAGAGG - Intronic
1125102494 15:35930665-35930687 AACTGTGTCTCCAGAGCAGGCGG - Intergenic
1125619367 15:41046070-41046092 ACTTGTTTCTACAGGGCAAACGG - Intronic
1127257339 15:57303402-57303424 ACTTCTGGCTCCGGGGTAAGCGG - Intergenic
1130093673 15:80840710-80840732 GCTGGTGTGTCCAGGGCAACTGG - Intronic
1130134049 15:81166957-81166979 ACTTGTAGCTCTAGGGGAAGGGG + Intronic
1130973985 15:88758829-88758851 GCTGGTGTGTCCAGGGGAAGTGG + Intergenic
1131068687 15:89450412-89450434 TCTTCTGGCTTCAGGGCAAGGGG - Intergenic
1131118897 15:89810957-89810979 ACTTGTGTCTCCAGGGCAAGTGG - Intronic
1132880521 16:2159939-2159961 AGGTGTGTCTCCAGGGAAAGGGG + Intronic
1135111112 16:19691500-19691522 ACTTGTGCTTTCAGAGCAAGGGG - Intronic
1135561173 16:23478251-23478273 AGATGTTTCTCCAGGGCGAGAGG + Intronic
1137520563 16:49191590-49191612 AACTGGGTCTCCAGGGAAAGGGG + Intergenic
1138243084 16:55444953-55444975 ACTTGTCTACCCAGGGCAAGGGG - Intronic
1140004545 16:71062230-71062252 ACCTGGGTCTCCAGGACCAGTGG + Exonic
1140877054 16:79162538-79162560 CCCTGTGTCTTCAGGGCTAGAGG - Intronic
1141341672 16:83209487-83209509 AAATGTGTCTCCAGGTAAAGTGG + Intronic
1142263556 16:89053482-89053504 ACCTGCGTCTCCAGGGTCAGAGG - Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1146692724 17:34887818-34887840 AGTTGTGTCTGCTGGACAAGAGG - Intergenic
1148486021 17:47991481-47991503 CCCTGTGTCTCCAGAGAAAGGGG - Intergenic
1148633371 17:49129137-49129159 TCTTGTGGCTCCAGTCCAAGAGG - Intergenic
1148647894 17:49229932-49229954 ACTGGAGTCTCCAGGGCCAAGGG - Intronic
1149421172 17:56511743-56511765 GGTTGTGTCTCTAGGGCACGGGG + Intergenic
1152374876 17:79913836-79913858 AGTTGTGGCTGCAGAGCAAGTGG + Intergenic
1153005670 18:497123-497145 ACTTGTGACTCCAGGGATGGAGG + Intronic
1154343229 18:13521907-13521929 GGTTTTGTCTCCATGGCAAGTGG + Intronic
1155053637 18:22168010-22168032 ACTTGTGGCTCCTGGGGGAGCGG - Intergenic
1156669722 18:39453525-39453547 GCTTGTGGCTCTAGGGGAAGTGG + Intergenic
1156814478 18:41293318-41293340 ACTTGTGTTTCAAGGGAATGGGG - Intergenic
1158531942 18:58270747-58270769 ACTTGTGGCTCCAAGGATAGAGG + Intronic
1159513251 18:69423574-69423596 ACATGTTTCTCCAGGGTATGTGG + Intronic
1164768023 19:30786692-30786714 ACTGGTGTTGCCAGGCCAAGAGG - Intergenic
1167163373 19:47781495-47781517 ACGTGTGTCCCCAGAGCGAGCGG + Intronic
1168237944 19:55075450-55075472 CCTTCTGTCTCCAGGGCCAGTGG - Intronic
925172358 2:1758108-1758130 ACGTGTGGCTCCAGGGCAGTGGG + Intergenic
925537352 2:4931870-4931892 ACTGGTGTCTCCTGGGTGAGAGG + Intergenic
925670312 2:6303849-6303871 ATGTGTGTCTCCAAGGCAAGAGG + Intergenic
926239217 2:11072092-11072114 AATTGTTTCTCCAGGGGATGTGG - Intergenic
928392386 2:30919550-30919572 CCTAGAGTCTCCAGGGCAAAAGG + Intronic
929705053 2:44201853-44201875 ACTTGTTTCTCCAGAGCCTGAGG + Exonic
929960216 2:46490631-46490653 TCTGGTGGCCCCAGGGCAAGTGG + Intergenic
933271538 2:80238217-80238239 ATTTGAGGCTCCAGGGCAAGGGG + Intronic
936920843 2:117686921-117686943 ACTTATGTATCCATGGCAACAGG + Intergenic
937261825 2:120591535-120591557 GCTTCTGCCTCCAGGGCAGGTGG + Intergenic
938672487 2:133599343-133599365 ACTGGTGTCTCTAGGGGTAGTGG + Intergenic
938966470 2:136393086-136393108 ACTTGAGTGCCCAGGCCAAGAGG + Intergenic
939690189 2:145250155-145250177 ACTTGTATCACCATGGGAAGGGG + Intergenic
940794755 2:158065241-158065263 ACTTCTGTGTCCAGGACAATGGG - Intronic
945761717 2:213923075-213923097 CCTGGTGTTTCCAGGGCAACAGG + Intronic
1168810201 20:700019-700041 ACTTCTGTTTCCAGGGCTTGGGG + Intergenic
1169684451 20:8255015-8255037 ACTTTTTTCTCCATTGCAAGTGG - Intronic
1171343534 20:24448460-24448482 AGAGGTGTCTCCAGAGCAAGAGG + Intergenic
1175217200 20:57397611-57397633 ACCTGGGTCCCCAGAGCAAGAGG + Intronic
1177269140 21:18822826-18822848 ATTCCTGTCTCAAGGGCAAGTGG - Intergenic
1178139811 21:29669897-29669919 AGTTTTTTCTCCAGGGCAAATGG + Intronic
1179433828 21:41345611-41345633 ACTTGTGGCACCAGGGCCTGGGG - Intronic
1183259986 22:36788394-36788416 GCTTAGGTCTTCAGGGCAAGGGG + Intergenic
1183483520 22:38077523-38077545 ACTTGGGTGTCCAGGGCCAGGGG - Intergenic
1184501912 22:44879554-44879576 ACTTGTGCCTCCAGGGCCACAGG - Intergenic
1185314266 22:50171945-50171967 CCTGGTGTCTCCAGGCCACGGGG - Intronic
949780508 3:7681637-7681659 TGTTGTGTCTCCAGAGCAAGTGG + Intronic
950125188 3:10506176-10506198 ATCTGTGTTTCCAGGGCCAGTGG + Intronic
950258947 3:11529936-11529958 CCTCCTGTCTCCTGGGCAAGAGG - Intronic
954611279 3:51945747-51945769 TCCTGTGTCTCCAGGGCCTGAGG + Intronic
957677582 3:83389969-83389991 GCTTGTTTCTCCAGGACTAGCGG - Intergenic
958878378 3:99640974-99640996 TCTTGTGTCTCTAGTGAAAGCGG - Intronic
966923967 3:184632742-184632764 TCTTCTGTCTGAAGGGCAAGTGG - Intronic
968131060 3:196193083-196193105 ACTGGTGTCTCCAGGCCAGAAGG - Intergenic
973063122 4:45754781-45754803 ACTTGTGGTTTCAGGGGAAGAGG - Intergenic
995678314 5:114688301-114688323 ATTACTGTCTCCAGGGAAAGTGG - Intergenic
996265954 5:121540522-121540544 ACTTGTGGGTGGAGGGCAAGAGG + Intergenic
996387062 5:122920030-122920052 ATGTGTCTCTCCAAGGCAAGAGG + Intronic
1000289648 5:159858593-159858615 AATTGTGCCTCCAGGCCAAGAGG - Intergenic
1000395343 5:160768991-160769013 ACTTGTGTTTCCATGACATGGGG - Intronic
1003020025 6:2501957-2501979 GGTTGTGTCTCCATGGGAAGGGG + Intergenic
1003611711 6:7620266-7620288 ACTCGTGTCTCCTGAGCAAGAGG - Intergenic
1004895951 6:20147970-20147992 GCTTGTGTCTCCTGGGGCAGAGG - Intronic
1006103531 6:31702093-31702115 GCATGTTTCTCCAGGGCACGGGG + Exonic
1007162123 6:39800303-39800325 CCTTGTGTCTCCTGGGCCTGGGG + Intronic
1008415284 6:51232817-51232839 ACTTGTGAGTCTAAGGCAAGAGG + Intergenic
1009428186 6:63537765-63537787 ATTTGTGTTTACATGGCAAGGGG + Intronic
1012974296 6:105763512-105763534 ACCTGGGTCTTCAGGGGAAGTGG - Intergenic
1013668540 6:112373655-112373677 ACTTCTGTCTCTGGGGCAACTGG - Intergenic
1019289254 7:242353-242375 CCTTGTGTGTACAGGGCAAGGGG + Intronic
1019933230 7:4237352-4237374 ACTGAAGTCTCCAGGGCAGGGGG + Intronic
1022236342 7:28465343-28465365 TCTCCAGTCTCCAGGGCAAGGGG + Intronic
1027763571 7:82309717-82309739 ACATGTGTGTCCATGGCACGTGG + Intronic
1030934673 7:115570743-115570765 TCTTGTGTTGCCAAGGCAAGAGG + Intergenic
1035377279 7:158413781-158413803 ACTTGTGTGTCCAGGCCCAGCGG + Intronic
1036455283 8:8901586-8901608 CTTTGTGTTTCCAGGTCAAGTGG + Intergenic
1037888560 8:22608540-22608562 ACCTGTGTGTCCAAGGCACGGGG - Intronic
1038869230 8:31475956-31475978 ACTTGTGTGTCCAGGGCAAAAGG + Intergenic
1039500788 8:38015180-38015202 ACTCTTGTCTCCCAGGCAAGTGG + Intergenic
1040683661 8:49843837-49843859 TGTTGTGTCTTCAGGCCAAGTGG + Intergenic
1042112493 8:65395567-65395589 ACTTGTGCATCAAGGGCAAATGG - Intergenic
1044752603 8:95430730-95430752 ACTTCTTTACCCAGGGCAAGTGG - Intergenic
1045663821 8:104465925-104465947 TGTTGTGTCCCCAGCGCAAGTGG + Intronic
1047279971 8:123436953-123436975 ATTTGTGTATCAAGGGCAATGGG - Intronic
1047984341 8:130217003-130217025 ACTTGGATATCCATGGCAAGTGG - Intronic
1049855014 8:144856173-144856195 CCAGGTGTCTCCAGGGCATGAGG + Intergenic
1051726550 9:20092721-20092743 ATTTGTGTGTGCAGGGCAGGGGG + Intergenic
1053667087 9:40324114-40324136 ACTGGTGTCTGCAGAGCCAGGGG + Intronic
1054517523 9:66052169-66052191 ACTGGTGTCTGCAGAGCCAGGGG - Intergenic
1056201276 9:84279300-84279322 GGTTGTGTTTCCAGGGAAAGTGG + Exonic
1060892141 9:127195706-127195728 GCCTGTGTCTCCAGGGCATTAGG + Intronic
1195918931 X:109963261-109963283 ACTTGTGTCTCCTGAGAGAGGGG + Intergenic
1197652790 X:129084170-129084192 ACTTGATTCTCCAGGACAACAGG + Intergenic
1198209051 X:134499006-134499028 ACTTCTGCCTCCAGAGTAAGAGG - Intronic
1200299077 X:154954239-154954261 AAATGTGTCCCCAGGACAAGAGG + Intronic