ID: 1131120826

View in Genome Browser
Species Human (GRCh38)
Location 15:89822616-89822638
Sequence GCCCTCCCTCGTCACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131120826_1131120832 1 Left 1131120826 15:89822616-89822638 CCCACACTGTGACGAGGGAGGGC No data
Right 1131120832 15:89822640-89822662 GGAGAAGGTGAGTGTCCATGGGG No data
1131120826_1131120833 12 Left 1131120826 15:89822616-89822638 CCCACACTGTGACGAGGGAGGGC No data
Right 1131120833 15:89822651-89822673 GTGTCCATGGGGCACTGTTGAGG No data
1131120826_1131120835 19 Left 1131120826 15:89822616-89822638 CCCACACTGTGACGAGGGAGGGC No data
Right 1131120835 15:89822658-89822680 TGGGGCACTGTTGAGGAATGAGG No data
1131120826_1131120830 -1 Left 1131120826 15:89822616-89822638 CCCACACTGTGACGAGGGAGGGC No data
Right 1131120830 15:89822638-89822660 CAGGAGAAGGTGAGTGTCCATGG No data
1131120826_1131120831 0 Left 1131120826 15:89822616-89822638 CCCACACTGTGACGAGGGAGGGC No data
Right 1131120831 15:89822639-89822661 AGGAGAAGGTGAGTGTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131120826 Original CRISPR GCCCTCCCTCGTCACAGTGT GGG (reversed) Intergenic
No off target data available for this crispr