ID: 1131120929

View in Genome Browser
Species Human (GRCh38)
Location 15:89823053-89823075
Sequence TGGTGACCAGCAGTGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131120921_1131120929 -1 Left 1131120921 15:89823031-89823053 CCAGAGGTGGCTTCAGGAGGCCT No data
Right 1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131120929 Original CRISPR TGGTGACCAGCAGTGGGGGA GGG Intergenic
No off target data available for this crispr