ID: 1131121030

View in Genome Browser
Species Human (GRCh38)
Location 15:89823524-89823546
Sequence CCTGCCCTGCCCTGCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131121030_1131121043 17 Left 1131121030 15:89823524-89823546 CCCCCAGGGCAGGGCAGGGCAGG No data
Right 1131121043 15:89823564-89823586 CTGGGTAGGAGGCAGCTTTGTGG No data
1131121030_1131121037 -2 Left 1131121030 15:89823524-89823546 CCCCCAGGGCAGGGCAGGGCAGG No data
Right 1131121037 15:89823545-89823567 GGGACCCTGCAGAGGAATGCTGG No data
1131121030_1131121038 -1 Left 1131121030 15:89823524-89823546 CCCCCAGGGCAGGGCAGGGCAGG No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121030_1131121042 6 Left 1131121030 15:89823524-89823546 CCCCCAGGGCAGGGCAGGGCAGG No data
Right 1131121042 15:89823553-89823575 GCAGAGGAATGCTGGGTAGGAGG No data
1131121030_1131121036 -10 Left 1131121030 15:89823524-89823546 CCCCCAGGGCAGGGCAGGGCAGG No data
Right 1131121036 15:89823537-89823559 GCAGGGCAGGGACCCTGCAGAGG No data
1131121030_1131121041 3 Left 1131121030 15:89823524-89823546 CCCCCAGGGCAGGGCAGGGCAGG No data
Right 1131121041 15:89823550-89823572 CCTGCAGAGGAATGCTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131121030 Original CRISPR CCTGCCCTGCCCTGCCCTGG GGG (reversed) Intergenic
No off target data available for this crispr