ID: 1131121036

View in Genome Browser
Species Human (GRCh38)
Location 15:89823537-89823559
Sequence GCAGGGCAGGGACCCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131121017_1131121036 25 Left 1131121017 15:89823489-89823511 CCACACCTAAGCACGGATGTGGT No data
Right 1131121036 15:89823537-89823559 GCAGGGCAGGGACCCTGCAGAGG No data
1131121025_1131121036 -1 Left 1131121025 15:89823515-89823537 CCCAGGAGTCCCCCAGGGCAGGG No data
Right 1131121036 15:89823537-89823559 GCAGGGCAGGGACCCTGCAGAGG No data
1131121027_1131121036 -2 Left 1131121027 15:89823516-89823538 CCAGGAGTCCCCCAGGGCAGGGC No data
Right 1131121036 15:89823537-89823559 GCAGGGCAGGGACCCTGCAGAGG No data
1131121023_1131121036 0 Left 1131121023 15:89823514-89823536 CCCCAGGAGTCCCCCAGGGCAGG No data
Right 1131121036 15:89823537-89823559 GCAGGGCAGGGACCCTGCAGAGG No data
1131121022_1131121036 1 Left 1131121022 15:89823513-89823535 CCCCCAGGAGTCCCCCAGGGCAG No data
Right 1131121036 15:89823537-89823559 GCAGGGCAGGGACCCTGCAGAGG No data
1131121030_1131121036 -10 Left 1131121030 15:89823524-89823546 CCCCCAGGGCAGGGCAGGGCAGG No data
Right 1131121036 15:89823537-89823559 GCAGGGCAGGGACCCTGCAGAGG No data
1131121018_1131121036 20 Left 1131121018 15:89823494-89823516 CCTAAGCACGGATGTGGTTCCCC No data
Right 1131121036 15:89823537-89823559 GCAGGGCAGGGACCCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131121036 Original CRISPR GCAGGGCAGGGACCCTGCAG AGG Intergenic
No off target data available for this crispr