ID: 1131121038

View in Genome Browser
Species Human (GRCh38)
Location 15:89823546-89823568
Sequence GGACCCTGCAGAGGAATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131121032_1131121038 -2 Left 1131121032 15:89823525-89823547 CCCCAGGGCAGGGCAGGGCAGGG 0: 13
1: 19
2: 41
3: 241
4: 1248
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121022_1131121038 10 Left 1131121022 15:89823513-89823535 CCCCCAGGAGTCCCCCAGGGCAG No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121025_1131121038 8 Left 1131121025 15:89823515-89823537 CCCAGGAGTCCCCCAGGGCAGGG No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121030_1131121038 -1 Left 1131121030 15:89823524-89823546 CCCCCAGGGCAGGGCAGGGCAGG No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121018_1131121038 29 Left 1131121018 15:89823494-89823516 CCTAAGCACGGATGTGGTTCCCC No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121034_1131121038 -3 Left 1131121034 15:89823526-89823548 CCCAGGGCAGGGCAGGGCAGGGA No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121027_1131121038 7 Left 1131121027 15:89823516-89823538 CCAGGAGTCCCCCAGGGCAGGGC No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121035_1131121038 -4 Left 1131121035 15:89823527-89823549 CCAGGGCAGGGCAGGGCAGGGAC No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data
1131121023_1131121038 9 Left 1131121023 15:89823514-89823536 CCCCAGGAGTCCCCCAGGGCAGG No data
Right 1131121038 15:89823546-89823568 GGACCCTGCAGAGGAATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131121038 Original CRISPR GGACCCTGCAGAGGAATGCT GGG Intergenic
No off target data available for this crispr