ID: 1131121184

View in Genome Browser
Species Human (GRCh38)
Location 15:89824203-89824225
Sequence TGCCCTGTGCTCTGCCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131121172_1131121184 29 Left 1131121172 15:89824151-89824173 CCTCCCTGTCCCCTATCCAATAG No data
Right 1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG No data
1131121178_1131121184 18 Left 1131121178 15:89824162-89824184 CCTATCCAATAGGCCTCAATTCT No data
Right 1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG No data
1131121176_1131121184 20 Left 1131121176 15:89824160-89824182 CCCCTATCCAATAGGCCTCAATT No data
Right 1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG No data
1131121179_1131121184 13 Left 1131121179 15:89824167-89824189 CCAATAGGCCTCAATTCTGCTCA No data
Right 1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG No data
1131121174_1131121184 26 Left 1131121174 15:89824154-89824176 CCCTGTCCCCTATCCAATAGGCC No data
Right 1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG No data
1131121177_1131121184 19 Left 1131121177 15:89824161-89824183 CCCTATCCAATAGGCCTCAATTC No data
Right 1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG No data
1131121180_1131121184 5 Left 1131121180 15:89824175-89824197 CCTCAATTCTGCTCAATTCTGCA No data
Right 1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG No data
1131121175_1131121184 25 Left 1131121175 15:89824155-89824177 CCTGTCCCCTATCCAATAGGCCT No data
Right 1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131121184 Original CRISPR TGCCCTGTGCTCTGCCTTAG GGG Intergenic
No off target data available for this crispr